Incidental Mutation 'R7250:Tenm2'
ID563859
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Nameteneurin transmembrane protein 2
Synonyms2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R7250 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location36006656-37235964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36072798 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 935 (L935F)
Ref Sequence ENSEMBL: ENSMUSP00000052014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: L935F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: L935F

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102801
AA Change: L934F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: L934F

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163524
AA Change: L934F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: L934F

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Actl7b T A 4: 56,741,035 M108L probably benign Het
Adgrf3 T A 5: 30,195,682 I934L probably damaging Het
Adprm A G 11: 67,041,624 V153A probably benign Het
Aif1l G A 2: 31,969,752 V109M probably damaging Het
Asphd1 T A 7: 126,946,770 E307V probably damaging Het
Ate1 T A 7: 130,519,971 probably benign Het
BC048403 T C 10: 121,745,471 S126P possibly damaging Het
BC067074 T G 13: 113,318,815 I465R Het
Borcs7 A G 19: 46,699,608 H64R probably damaging Het
C1qtnf1 A G 11: 118,448,350 *282W probably null Het
Cacna1c A G 6: 118,598,005 C1985R Het
Cacna1c A T 6: 118,696,451 V647E Het
Cacna1d A G 14: 30,075,151 S1497P probably damaging Het
Cacna1e T A 1: 154,700,489 I133F possibly damaging Het
Ccdc63 A T 5: 122,122,843 L206H probably damaging Het
Ccdc84 A G 9: 44,412,451 probably null Het
D430041D05Rik T C 2: 104,256,616 T672A possibly damaging Het
D630045J12Rik G T 6: 38,142,611 T1732K possibly damaging Het
D930020B18Rik T C 10: 121,671,831 I158T probably damaging Het
Ddx52 G A 11: 83,944,566 G106D probably benign Het
Dock2 A G 11: 34,695,205 V550A probably benign Het
Dock2 C T 11: 34,695,293 D521N probably damaging Het
F13b T C 1: 139,516,489 probably null Het
Fchsd2 A G 7: 101,259,685 K431R possibly damaging Het
Fez1 C T 9: 36,867,794 R256C probably damaging Het
Gjd4 T A 18: 9,280,391 Q229L probably benign Het
Gpr45 T A 1: 43,032,371 I58N probably damaging Het
Gstm1 T A 3: 108,016,393 I99F probably damaging Het
Gtpbp8 T A 16: 44,743,862 T149S probably damaging Het
H2-Ab1 A G 17: 34,267,507 D180G probably damaging Het
Hdhd5 A G 6: 120,517,055 I188T possibly damaging Het
Hfm1 T C 5: 106,904,331 I300V probably benign Het
Hnrnpr T G 4: 136,332,435 D283E probably benign Het
Hsp90b1 T C 10: 86,691,708 E768G unknown Het
Kcna4 C A 2: 107,296,318 Q466K possibly damaging Het
Kcnk6 A G 7: 29,232,194 L97P probably benign Het
Kdelc2 C T 9: 53,390,521 Q158* probably null Het
Klf5 A G 14: 99,299,019 S9G probably benign Het
Kmt2c C A 5: 25,299,491 K3606N probably damaging Het
Kmt2c T C 5: 25,309,807 T3013A probably benign Het
Lancl1 A G 1: 67,009,299 Y207H possibly damaging Het
Lipe G C 7: 25,388,660 probably benign Het
Lrrc66 T A 5: 73,610,881 H239L probably benign Het
Ltbp2 C T 12: 84,787,392 W1441* probably null Het
Man2a1 T C 17: 64,636,588 S213P probably benign Het
Mapre2 C T 18: 23,858,062 A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 D1155E probably damaging Het
Mki67 T C 7: 135,699,324 D1327G possibly damaging Het
Mx2 T C 16: 97,547,464 I279T probably damaging Het
Myo5c A G 9: 75,262,215 T441A probably damaging Het
Nlrp9a T G 7: 26,558,718 V587G possibly damaging Het
Npas2 A T 1: 39,338,107 T517S probably damaging Het
Npy1r T C 8: 66,705,060 S341P probably benign Het
Ntm A G 9: 29,411,692 W11R probably benign Het
Nxpe2 A T 9: 48,326,796 I53N possibly damaging Het
Olfr456 A G 6: 42,486,755 V146A probably benign Het
Olfr655 A T 7: 104,596,531 Y217N probably damaging Het
Olfr981 T A 9: 40,022,754 Y120* probably null Het
Onecut2 T C 18: 64,386,440 F443L probably benign Het
Parp2 T A 14: 50,817,344 V248E probably benign Het
Pcdh12 C A 18: 38,281,976 V699L probably benign Het
Pja2 G A 17: 64,309,456 P148L probably benign Het
Ppip5k2 T G 1: 97,745,462 D415A probably benign Het
Prss47 A G 13: 65,052,541 S74P probably benign Het
Ptprg G T 14: 12,166,767 M723I probably benign Het
Qsox2 A T 2: 26,228,432 I109N probably damaging Het
Ranbp3l A G 15: 9,011,980 E217G probably benign Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rgs12 T A 5: 34,965,497 F208Y probably damaging Het
Rin3 C T 12: 102,368,634 T268I unknown Het
Rttn T A 18: 88,989,523 D427E probably benign Het
Samd13 G A 3: 146,646,324 P91S probably benign Het
Samd9l T C 6: 3,374,201 D1020G possibly damaging Het
Sec62 T G 3: 30,812,347 L201V possibly damaging Het
Setdb1 C T 3: 95,354,541 probably null Het
Sf3a3 A T 4: 124,722,915 T197S probably benign Het
Slc20a1 A T 2: 129,209,924 I618F possibly damaging Het
Slc38a3 A T 9: 107,656,666 M186K probably benign Het
Slc39a13 T C 2: 91,063,158 T319A probably benign Het
Slc44a4 T C 17: 34,918,544 probably null Het
St3gal1 A C 15: 67,106,729 D314E possibly damaging Het
Suclg1 A G 6: 73,271,091 N265S probably benign Het
Sult2b1 A T 7: 45,783,937 V2D unknown Het
Supv3l1 T A 10: 62,445,067 I182F probably damaging Het
Tcp11l2 T C 10: 84,587,241 probably null Het
Tnks T A 8: 34,851,758 I790F probably damaging Het
Top2b C T 14: 16,420,411 T1274I probably benign Het
Tpi1 A T 6: 124,812,478 I178N probably damaging Het
Trav9d-1 A T 14: 52,792,696 S86C probably damaging Het
Treml2 A G 17: 48,309,127 E265G probably benign Het
Trpm7 A T 2: 126,826,765 S744T possibly damaging Het
Usp33 T A 3: 152,392,362 L909* probably null Het
Vcan A G 13: 89,721,686 I210T probably damaging Het
Vcan A T 13: 89,731,457 probably null Het
Vsig10l A T 7: 43,463,675 D17V probably benign Het
Zbtb7b T A 3: 89,379,669 T498S probably benign Het
Zfp366 T A 13: 99,229,568 H412Q probably damaging Het
Zfp53 C A 17: 21,509,578 D624E probably damaging Het
Zfp827 A T 8: 79,190,092 D432V Het
Zic1 T C 9: 91,364,975 T15A probably damaging Het
Zswim8 T C 14: 20,719,968 C1368R probably damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
mosaic UTSW 11 36063775 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
R7834:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R7838:Tenm2 UTSW 11 36106799 missense probably benign 0.02
R8073:Tenm2 UTSW 11 36139644 missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 36027221 missense probably benign 0.23
R8109:Tenm2 UTSW 11 36008310 missense probably benign
R8306:Tenm2 UTSW 11 36069369 missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8452:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8864:Tenm2 UTSW 11 36027195 missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 36051961 missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36944034 missense probably damaging 0.98
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36008234 missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36300335 missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 36385130 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCCTTAGAGGTCTGGCCAG -3'
(R):5'- CAATTTTGAAGGTCTTCTCCTGG -3'

Sequencing Primer
(F):5'- CAGGTGGCCATTACATTGTACTAC -3'
(R):5'- GAAGGTCTTCTCCTGGTCTAGATAC -3'
Posted On2019-06-26