Mutagenetix > Incidental Mutation

Incidental Mutation 'R7250:Tenm2'

563859

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.471) question?

Stock #

R7250 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 36072798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 935 (L935F)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: L935F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: L935F

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102801
AA Change: L934F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: L934F

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163524
AA Change: L934F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: L934F

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	G	T	X: 78,370,705	M345I	probably benign	Het
Actl7b	T	A	4: 56,741,035	M108L	probably benign	Het
Adgrf3	T	A	5: 30,195,682	I934L	probably damaging	Het
Adprm	A	G	11: 67,041,624	V153A	probably benign	Het
Aif1l	G	A	2: 31,969,752	V109M	probably damaging	Het
Asphd1	T	A	7: 126,946,770	E307V	probably damaging	Het
Ate1	T	A	7: 130,519,971		probably benign	Het
BC048403	T	C	10: 121,745,471	S126P	possibly damaging	Het
BC067074	T	G	13: 113,318,815	I465R		Het
Borcs7	A	G	19: 46,699,608	H64R	probably damaging	Het
C1qtnf1	A	G	11: 118,448,350	*282W	probably null	Het
Cacna1c	A	G	6: 118,598,005	C1985R		Het
Cacna1c	A	T	6: 118,696,451	V647E		Het
Cacna1d	A	G	14: 30,075,151	S1497P	probably damaging	Het
Cacna1e	T	A	1: 154,700,489	I133F	possibly damaging	Het
Ccdc63	A	T	5: 122,122,843	L206H	probably damaging	Het
Ccdc84	A	G	9: 44,412,451		probably null	Het
D430041D05Rik	T	C	2: 104,256,616	T672A	possibly damaging	Het
D630045J12Rik	G	T	6: 38,142,611	T1732K	possibly damaging	Het
D930020B18Rik	T	C	10: 121,671,831	I158T	probably damaging	Het
Ddx52	G	A	11: 83,944,566	G106D	probably benign	Het
Dock2	A	G	11: 34,695,205	V550A	probably benign	Het
Dock2	C	T	11: 34,695,293	D521N	probably damaging	Het
F13b	T	C	1: 139,516,489		probably null	Het
Fchsd2	A	G	7: 101,259,685	K431R	possibly damaging	Het
Fez1	C	T	9: 36,867,794	R256C	probably damaging	Het
Gjd4	T	A	18: 9,280,391	Q229L	probably benign	Het
Gpr45	T	A	1: 43,032,371	I58N	probably damaging	Het
Gstm1	T	A	3: 108,016,393	I99F	probably damaging	Het
Gtpbp8	T	A	16: 44,743,862	T149S	probably damaging	Het
H2-Ab1	A	G	17: 34,267,507	D180G	probably damaging	Het
Hdhd5	A	G	6: 120,517,055	I188T	possibly damaging	Het
Hfm1	T	C	5: 106,904,331	I300V	probably benign	Het
Hnrnpr	T	G	4: 136,332,435	D283E	probably benign	Het
Hsp90b1	T	C	10: 86,691,708	E768G	unknown	Het
Kcna4	C	A	2: 107,296,318	Q466K	possibly damaging	Het
Kcnk6	A	G	7: 29,232,194	L97P	probably benign	Het
Kdelc2	C	T	9: 53,390,521	Q158*	probably null	Het
Klf5	A	G	14: 99,299,019	S9G	probably benign	Het
Kmt2c	C	A	5: 25,299,491	K3606N	probably damaging	Het
Kmt2c	T	C	5: 25,309,807	T3013A	probably benign	Het
Lancl1	A	G	1: 67,009,299	Y207H	possibly damaging	Het
Lipe	G	C	7: 25,388,660		probably benign	Het
Lrrc66	T	A	5: 73,610,881	H239L	probably benign	Het
Ltbp2	C	T	12: 84,787,392	W1441*	probably null	Het
Man2a1	T	C	17: 64,636,588	S213P	probably benign	Het
Mapre2	C	T	18: 23,858,062	A171V	possibly damaging	Het
Mdn1	T	A	4: 32,695,427	D1155E	probably damaging	Het
Mki67	T	C	7: 135,699,324	D1327G	possibly damaging	Het
Mx2	T	C	16: 97,547,464	I279T	probably damaging	Het
Myo5c	A	G	9: 75,262,215	T441A	probably damaging	Het
Nlrp9a	T	G	7: 26,558,718	V587G	possibly damaging	Het
Npas2	A	T	1: 39,338,107	T517S	probably damaging	Het
Npy1r	T	C	8: 66,705,060	S341P	probably benign	Het
Ntm	A	G	9: 29,411,692	W11R	probably benign	Het
Nxpe2	A	T	9: 48,326,796	I53N	possibly damaging	Het
Olfr456	A	G	6: 42,486,755	V146A	probably benign	Het
Olfr655	A	T	7: 104,596,531	Y217N	probably damaging	Het
Olfr981	T	A	9: 40,022,754	Y120*	probably null	Het
Onecut2	T	C	18: 64,386,440	F443L	probably benign	Het
Parp2	T	A	14: 50,817,344	V248E	probably benign	Het
Pcdh12	C	A	18: 38,281,976	V699L	probably benign	Het
Pja2	G	A	17: 64,309,456	P148L	probably benign	Het
Ppip5k2	T	G	1: 97,745,462	D415A	probably benign	Het
Prss47	A	G	13: 65,052,541	S74P	probably benign	Het
Ptprg	G	T	14: 12,166,767	M723I	probably benign	Het
Qsox2	A	T	2: 26,228,432	I109N	probably damaging	Het
Ranbp3l	A	G	15: 9,011,980	E217G	probably benign	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rgs12	T	A	5: 34,965,497	F208Y	probably damaging	Het
Rin3	C	T	12: 102,368,634	T268I	unknown	Het
Rttn	T	A	18: 88,989,523	D427E	probably benign	Het
Samd13	G	A	3: 146,646,324	P91S	probably benign	Het
Samd9l	T	C	6: 3,374,201	D1020G	possibly damaging	Het
Sec62	T	G	3: 30,812,347	L201V	possibly damaging	Het
Setdb1	C	T	3: 95,354,541		probably null	Het
Sf3a3	A	T	4: 124,722,915	T197S	probably benign	Het
Slc20a1	A	T	2: 129,209,924	I618F	possibly damaging	Het
Slc38a3	A	T	9: 107,656,666	M186K	probably benign	Het
Slc39a13	T	C	2: 91,063,158	T319A	probably benign	Het
Slc44a4	T	C	17: 34,918,544		probably null	Het
St3gal1	A	C	15: 67,106,729	D314E	possibly damaging	Het
Suclg1	A	G	6: 73,271,091	N265S	probably benign	Het
Sult2b1	A	T	7: 45,783,937	V2D	unknown	Het
Supv3l1	T	A	10: 62,445,067	I182F	probably damaging	Het
Tcp11l2	T	C	10: 84,587,241		probably null	Het
Tnks	T	A	8: 34,851,758	I790F	probably damaging	Het
Top2b	C	T	14: 16,420,411	T1274I	probably benign	Het
Tpi1	A	T	6: 124,812,478	I178N	probably damaging	Het
Trav9d-1	A	T	14: 52,792,696	S86C	probably damaging	Het
Treml2	A	G	17: 48,309,127	E265G	probably benign	Het
Trpm7	A	T	2: 126,826,765	S744T	possibly damaging	Het
Usp33	T	A	3: 152,392,362	L909*	probably null	Het
Vcan	A	G	13: 89,721,686	I210T	probably damaging	Het
Vcan	A	T	13: 89,731,457		probably null	Het
Vsig10l	A	T	7: 43,463,675	D17V	probably benign	Het
Zbtb7b	T	A	3: 89,379,669	T498S	probably benign	Het
Zfp366	T	A	13: 99,229,568	H412Q	probably damaging	Het
Zfp53	C	A	17: 21,509,578	D624E	probably damaging	Het
Zfp827	A	T	8: 79,190,092	D432V		Het
Zic1	T	C	9: 91,364,975	T15A	probably damaging	Het
Zswim8	T	C	14: 20,719,968	C1368R	probably damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTCCTTAGAGGTCTGGCCAG -3'
(R):5'- CAATTTTGAAGGTCTTCTCCTGG -3'

Sequencing Primer
(F):5'- CAGGTGGCCATTACATTGTACTAC -3'
(R):5'- GAAGGTCTTCTCCTGGTCTAGATAC -3'

Posted On

2019-06-26