Incidental Mutation 'R7250:Rgl2'
ID 563882
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 045350-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7250 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34152403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 367 (R367W)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047503
AA Change: R367W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: R367W

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 77,414,311 (GRCm39) M345I probably benign Het
Actl7b T A 4: 56,741,035 (GRCm39) M108L probably benign Het
Adgrf3 T A 5: 30,400,680 (GRCm39) I934L probably damaging Het
Adprm A G 11: 66,932,450 (GRCm39) V153A probably benign Het
Aif1l G A 2: 31,859,764 (GRCm39) V109M probably damaging Het
Asphd1 T A 7: 126,545,942 (GRCm39) E307V probably damaging Het
Ate1 T A 7: 130,121,701 (GRCm39) probably benign Het
Borcs7 A G 19: 46,688,047 (GRCm39) H64R probably damaging Het
C1qtnf1 A G 11: 118,339,176 (GRCm39) *282W probably null Het
Cacna1c A G 6: 118,574,966 (GRCm39) C1985R Het
Cacna1c A T 6: 118,673,412 (GRCm39) V647E Het
Cacna1d A G 14: 29,797,108 (GRCm39) S1497P probably damaging Het
Cacna1e T A 1: 154,576,235 (GRCm39) I133F possibly damaging Het
Ccdc63 A T 5: 122,260,906 (GRCm39) L206H probably damaging Het
Cenatac A G 9: 44,323,748 (GRCm39) probably null Het
Cspg4b T G 13: 113,455,349 (GRCm39) I465R Het
D430041D05Rik T C 2: 104,086,961 (GRCm39) T672A possibly damaging Het
D630045J12Rik G T 6: 38,119,546 (GRCm39) T1732K possibly damaging Het
D930020B18Rik T C 10: 121,507,736 (GRCm39) I158T probably damaging Het
Ddx52 G A 11: 83,835,392 (GRCm39) G106D probably benign Het
Dock2 A G 11: 34,586,032 (GRCm39) V550A probably benign Het
Dock2 C T 11: 34,586,120 (GRCm39) D521N probably damaging Het
F13b T C 1: 139,444,227 (GRCm39) probably null Het
Fchsd2 A G 7: 100,908,892 (GRCm39) K431R possibly damaging Het
Fez1 C T 9: 36,779,090 (GRCm39) R256C probably damaging Het
Gjd4 T A 18: 9,280,391 (GRCm39) Q229L probably benign Het
Gpr45 T A 1: 43,071,531 (GRCm39) I58N probably damaging Het
Gstm1 T A 3: 107,923,709 (GRCm39) I99F probably damaging Het
Gtpbp8 T A 16: 44,564,225 (GRCm39) T149S probably damaging Het
H2-Ab1 A G 17: 34,486,481 (GRCm39) D180G probably damaging Het
Hdhd5 A G 6: 120,494,016 (GRCm39) I188T possibly damaging Het
Hfm1 T C 5: 107,052,197 (GRCm39) I300V probably benign Het
Hnrnpr T G 4: 136,059,746 (GRCm39) D283E probably benign Het
Hsp90b1 T C 10: 86,527,572 (GRCm39) E768G unknown Het
Kcna4 C A 2: 107,126,663 (GRCm39) Q466K possibly damaging Het
Kcnk6 A G 7: 28,931,619 (GRCm39) L97P probably benign Het
Kics2 T C 10: 121,581,376 (GRCm39) S126P possibly damaging Het
Klf5 A G 14: 99,536,455 (GRCm39) S9G probably benign Het
Kmt2c C A 5: 25,504,489 (GRCm39) K3606N probably damaging Het
Kmt2c T C 5: 25,514,805 (GRCm39) T3013A probably benign Het
Lancl1 A G 1: 67,048,458 (GRCm39) Y207H possibly damaging Het
Lipe G C 7: 25,088,085 (GRCm39) probably benign Het
Lrrc66 T A 5: 73,768,224 (GRCm39) H239L probably benign Het
Ltbp2 C T 12: 84,834,166 (GRCm39) W1441* probably null Het
Man2a1 T C 17: 64,943,583 (GRCm39) S213P probably benign Het
Mapre2 C T 18: 23,991,119 (GRCm39) A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 (GRCm39) D1155E probably damaging Het
Mki67 T C 7: 135,301,053 (GRCm39) D1327G possibly damaging Het
Mx2 T C 16: 97,348,664 (GRCm39) I279T probably damaging Het
Myo5c A G 9: 75,169,497 (GRCm39) T441A probably damaging Het
Nlrp9a T G 7: 26,258,143 (GRCm39) V587G possibly damaging Het
Npas2 A T 1: 39,377,188 (GRCm39) T517S probably damaging Het
Npy1r T C 8: 67,157,712 (GRCm39) S341P probably benign Het
Ntm A G 9: 29,322,988 (GRCm39) W11R probably benign Het
Nxpe2 A T 9: 48,238,096 (GRCm39) I53N possibly damaging Het
Onecut2 T C 18: 64,519,511 (GRCm39) F443L probably benign Het
Or10g6 T A 9: 39,934,050 (GRCm39) Y120* probably null Het
Or2r2 A G 6: 42,463,689 (GRCm39) V146A probably benign Het
Or52ac1 A T 7: 104,245,738 (GRCm39) Y217N probably damaging Het
Parp2 T A 14: 51,054,801 (GRCm39) V248E probably benign Het
Pcdh12 C A 18: 38,415,029 (GRCm39) V699L probably benign Het
Pja2 G A 17: 64,616,451 (GRCm39) P148L probably benign Het
Poglut3 C T 9: 53,301,821 (GRCm39) Q158* probably null Het
Ppip5k2 T G 1: 97,673,187 (GRCm39) D415A probably benign Het
Prss47 A G 13: 65,200,355 (GRCm39) S74P probably benign Het
Ptprg G T 14: 12,166,767 (GRCm38) M723I probably benign Het
Qsox2 A T 2: 26,118,444 (GRCm39) I109N probably damaging Het
Ranbp3l A G 15: 9,041,853 (GRCm39) E217G probably benign Het
Rgs12 T A 5: 35,122,841 (GRCm39) F208Y probably damaging Het
Rin3 C T 12: 102,334,893 (GRCm39) T268I unknown Het
Rttn T A 18: 89,007,647 (GRCm39) D427E probably benign Het
Samd13 G A 3: 146,352,079 (GRCm39) P91S probably benign Het
Samd9l T C 6: 3,374,201 (GRCm39) D1020G possibly damaging Het
Sec62 T G 3: 30,866,496 (GRCm39) L201V possibly damaging Het
Setdb1 C T 3: 95,261,852 (GRCm39) probably null Het
Sf3a3 A T 4: 124,616,708 (GRCm39) T197S probably benign Het
Slc20a1 A T 2: 129,051,844 (GRCm39) I618F possibly damaging Het
Slc38a3 A T 9: 107,533,865 (GRCm39) M186K probably benign Het
Slc39a13 T C 2: 90,893,503 (GRCm39) T319A probably benign Het
Slc44a4 T C 17: 35,137,520 (GRCm39) probably null Het
St3gal1 A C 15: 66,978,578 (GRCm39) D314E possibly damaging Het
Suclg1 A G 6: 73,248,074 (GRCm39) N265S probably benign Het
Sult2b1 A T 7: 45,433,361 (GRCm39) V2D unknown Het
Supv3l1 T A 10: 62,280,846 (GRCm39) I182F probably damaging Het
Tcp11l2 T C 10: 84,423,105 (GRCm39) probably null Het
Tenm2 C A 11: 35,963,625 (GRCm39) L935F probably damaging Het
Tnks T A 8: 35,318,912 (GRCm39) I790F probably damaging Het
Top2b C T 14: 16,420,411 (GRCm38) T1274I probably benign Het
Tpi1 A T 6: 124,789,441 (GRCm39) I178N probably damaging Het
Trav9d-1 A T 14: 53,030,153 (GRCm39) S86C probably damaging Het
Treml2 A G 17: 48,616,155 (GRCm39) E265G probably benign Het
Trpm7 A T 2: 126,668,685 (GRCm39) S744T possibly damaging Het
Usp33 T A 3: 152,097,999 (GRCm39) L909* probably null Het
Vcan A G 13: 89,869,805 (GRCm39) I210T probably damaging Het
Vcan A T 13: 89,879,576 (GRCm39) probably null Het
Vsig10l A T 7: 43,113,099 (GRCm39) D17V probably benign Het
Zbtb7b T A 3: 89,286,976 (GRCm39) T498S probably benign Het
Zfp366 T A 13: 99,366,076 (GRCm39) H412Q probably damaging Het
Zfp53 C A 17: 21,729,840 (GRCm39) D624E probably damaging Het
Zfp827 A T 8: 79,916,721 (GRCm39) D432V Het
Zic1 T C 9: 91,247,028 (GRCm39) T15A probably damaging Het
Zswim8 T C 14: 20,770,036 (GRCm39) C1368R probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGACTGTGAGACCACTG -3'
(R):5'- CTCTGGGAATAATTATCCTCCTCTGAG -3'

Sequencing Primer
(F):5'- CTCCTAGAGAAGTGGATCCGTG -3'
(R):5'- ATCCTCCTCTGAGAAAATCTGGC -3'
Posted On 2019-06-26