Incidental Mutation 'R7250:H2-Ab1'

• ID: 563883
• Institutional Source: Beutler Lab
• Gene Symbol: H2-Ab1
• Ensembl Gene: ENSMUSG00000073421
• Gene Name: histocompatibility 2, class II antigen A, beta 1
• Synonyms: A beta, Abeta, Ia-2, IAb, Rmcs1, I-A, H-2Ab, I-Abeta, Ia2, H2-Ab
• Is this an essential gene?: Probably non essential (E-score: 0.061)
• Stock #: R7250 (G1)
• Quality Score: 225.009
• Status: Not validated
• Chromosome: 17
• Chromosomal Location: 34263209-34269418 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 34267507 bp
• Zygosity: Heterozygous
• Amino Acid Change: Aspartic acid to Glycine at position 180 (D180G)
• Ref Sequence: ENSEMBL: ENSMUSP00000041008
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000040828]

CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION] Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION] Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION] Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION] Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION] Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION] J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION] J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION] 14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]

• Predicted Effect: probably damaging; Transcript: ENSMUST00000040828; AA Change: D180G; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
• SMART Domains: Protein: ENSMUSP00000041008; Gene: ENSMUSG00000073421; AA Change: D180G

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
MHC_II_beta	40	114	1.53e-47	SMART
IGc1	140	211	8.47e-34	SMART
transmembrane domain	228	247	N/A	INTRINSIC

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit depletion of mature CD4+ T cells, deficiency in cell-mediated immune responses, and increased susceptibility to viral infections. [provided by MGI curators]
• Posted On: 2019-06-26

Predicted Primers

PCR Primer
(F):5'- CAGCCCAATGTCGTCATCTC -3'
(R):5'- AGCTCAGTAGTGGAAGCAGATC -3'

Sequencing Primer
(F):5'- AATGTCGTCATCTCCCTGTCCAG -3'
(R):5'- CTCAGTAGTGGAAGCAGATCATATAG -3'