Mutagenetix > Incidental Mutation

Incidental Mutation 'R7251:Raph1'

563897

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R7251 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60489868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 745 (F745L)

Ref Sequence

ENSEMBL: ENSMUSP00000121023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090293

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: F745L

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: F745L

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182085

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	G	T	X: 78,370,705	M345I	probably benign	Het
Adamts19	A	T	18: 58,837,902	D186V	probably damaging	Het
Agrn	T	C	4: 156,174,606	D884G	probably damaging	Het
Akr1c6	T	A	13: 4,447,020	C154S	probably damaging	Het
Apob	T	C	12: 8,007,037	Y1840H	probably damaging	Het
Arfgef1	T	C	1: 10,198,975	E399G	possibly damaging	Het
Arg2	G	A	12: 79,150,798	G197S	probably damaging	Het
Arhgap32	T	C	9: 32,208,185	V308A	probably damaging	Het
Atcay	A	T	10: 81,210,532	C319*	probably null	Het
Bend4	C	G	5: 67,427,533	R16P	unknown	Het
Braf	A	G	6: 39,677,570		probably null	Het
Camsap1	T	C	2: 25,938,886	E942G	probably damaging	Het
Cdpf1	C	T	15: 85,809,293	G11D	probably damaging	Het
Cgn	T	C	3: 94,776,199	E382G	possibly damaging	Het
Cndp1	T	A	18: 84,622,197	E294D	probably benign	Het
Cnn1	T	A	9: 22,108,217	Y294N	unknown	Het
Cyp2ab1	A	G	16: 20,315,896	F104S	possibly damaging	Het
Cyp2t4	G	A	7: 27,157,719	V336M	possibly damaging	Het
D430041D05Rik	T	A	2: 104,221,166	D782V	probably damaging	Het
Ddx39b	A	G	17: 35,253,488	*429W	probably null	Het
Dgkb	T	C	12: 37,981,986	S16P	possibly damaging	Het
Dll4	T	C	2: 119,332,292	C465R	probably damaging	Het
Dsp	A	G	13: 38,193,548	I1770V	probably benign	Het
Fbxw11	A	G	11: 32,731,370	N250S	probably benign	Het
Fsip2	G	A	2: 82,979,081	V1915M	possibly damaging	Het
Greb1l	G	A	18: 10,515,319	V704M	probably damaging	Het
Hgf	T	A	5: 16,593,944	N323K	possibly damaging	Het
Hhatl	A	T	9: 121,785,050		probably null	Het
Hip1r	T	C	5: 123,994,750	S204P	probably damaging	Het
Igsf10	T	A	3: 59,319,454	N2266I	probably damaging	Het
Krtap15	A	G	16: 88,829,094		probably null	Het
Lrp1	T	C	10: 127,572,554	D1751G	probably damaging	Het
Madd	A	T	2: 91,162,176	D1050E	probably benign	Het
Man1c1	C	T	4: 134,580,836	G323R	probably damaging	Het
Mgll	A	G	6: 88,823,375	E252G	probably benign	Het
Muc2	A	G	7: 141,692,722	N145S	possibly damaging	Het
Ncoa2	C	T	1: 13,148,375	S1410N	probably benign	Het
Nek10	A	G	14: 14,853,965	T384A	probably benign	Het
Nexn	T	C	3: 152,247,195	E310G	probably damaging	Het
Nol10	T	C	12: 17,402,107	L354P	probably damaging	Het
Npy4r	T	C	14: 34,146,915	R139G	probably damaging	Het
Nup160	A	G	2: 90,700,174	E463G	probably damaging	Het
Olfr1062	G	A	2: 86,423,596	L27F	probably benign	Het
Olfr301	T	C	7: 86,413,001	V213A	probably benign	Het
Olfr622	C	T	7: 103,639,702	G146D	probably damaging	Het
Pdzd8	A	T	19: 59,300,645	N774K	possibly damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pot1a	T	C	6: 25,752,498		probably null	Het
Ppip5k1	T	A	2: 121,347,571	E283D	probably benign	Het
Ptpn2	A	C	18: 67,675,792	I318R	possibly damaging	Het
Rgs19	C	T	2: 181,689,748	V88I	probably benign	Het
Ripk4	A	G	16: 97,743,249	S733P	probably benign	Het
Rprd1b	T	A	2: 158,028,979	W29R	probably damaging	Het
Rtkn	A	G	6: 83,135,962	N5S	probably damaging	Het
Sh3bp5l	A	T	11: 58,341,302	Q131L	probably damaging	Het
Slain2	T	A	5: 72,974,548	F461I	possibly damaging	Het
Stk24	A	T	14: 121,308,022	L108Q	probably damaging	Het
Syne3	TC	T	12: 104,961,571		probably null	Het
Tapbpl	A	T	6: 125,226,595	V374E	probably damaging	Het
Tax1bp1	A	G	6: 52,721,356	I18V	possibly damaging	Het
Tecta	T	A	9: 42,387,752	I233F	probably damaging	Het
Tet3	A	G	6: 83,404,056	S377P	probably benign	Het
Uty	A	G	Y: 1,154,262	S721P	probably benign	Het
Wnk4	C	A	11: 101,265,153	T412K	possibly damaging	Het
Zdhhc11	G	T	13: 73,992,097	V336L	probably benign	Het
Zfp605	T	A	5: 110,127,960	S315T	probably damaging	Het
Zfp746	A	G	6: 48,064,877	L305P	probably damaging	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGTGCTACTACTGGTGACACAG -3'
(R):5'- AATCACCAGGCTGCAAAATG -3'

Sequencing Primer
(F):5'- ACAGTCTTTGTGCTGGCTGAAG -3'
(R):5'- AGGGACCCTGTTTAAGTCTCCAAC -3'

Posted On

2019-06-26