Incidental Mutation 'R7251:Olfr1062'
ID563901
Institutional Source Beutler Lab
Gene Symbol Olfr1062
Ensembl Gene ENSMUSG00000090059
Gene Nameolfactory receptor 1062
SynonymsGA_x6K02T2Q125-47892992-47892045, MOR185-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7251 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86420399-86426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86423596 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 27 (L27F)
Ref Sequence ENSEMBL: ENSMUSP00000149742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105213] [ENSMUST00000217481]
Predicted Effect probably benign
Transcript: ENSMUST00000105213
AA Change: L27F

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100848
Gene: ENSMUSG00000090059
AA Change: L27F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-46 PFAM
Pfam:7tm_1 41 290 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217481
AA Change: L27F

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Adamts19 A T 18: 58,837,902 D186V probably damaging Het
Agrn T C 4: 156,174,606 D884G probably damaging Het
Akr1c6 T A 13: 4,447,020 C154S probably damaging Het
Apob T C 12: 8,007,037 Y1840H probably damaging Het
Arfgef1 T C 1: 10,198,975 E399G possibly damaging Het
Arg2 G A 12: 79,150,798 G197S probably damaging Het
Arhgap32 T C 9: 32,208,185 V308A probably damaging Het
Atcay A T 10: 81,210,532 C319* probably null Het
Bend4 C G 5: 67,427,533 R16P unknown Het
Braf A G 6: 39,677,570 probably null Het
Camsap1 T C 2: 25,938,886 E942G probably damaging Het
Cdpf1 C T 15: 85,809,293 G11D probably damaging Het
Cgn T C 3: 94,776,199 E382G possibly damaging Het
Cndp1 T A 18: 84,622,197 E294D probably benign Het
Cnn1 T A 9: 22,108,217 Y294N unknown Het
Cyp2ab1 A G 16: 20,315,896 F104S possibly damaging Het
Cyp2t4 G A 7: 27,157,719 V336M possibly damaging Het
D430041D05Rik T A 2: 104,221,166 D782V probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dgkb T C 12: 37,981,986 S16P possibly damaging Het
Dll4 T C 2: 119,332,292 C465R probably damaging Het
Dsp A G 13: 38,193,548 I1770V probably benign Het
Fbxw11 A G 11: 32,731,370 N250S probably benign Het
Fsip2 G A 2: 82,979,081 V1915M possibly damaging Het
Greb1l G A 18: 10,515,319 V704M probably damaging Het
Hgf T A 5: 16,593,944 N323K possibly damaging Het
Hhatl A T 9: 121,785,050 probably null Het
Hip1r T C 5: 123,994,750 S204P probably damaging Het
Igsf10 T A 3: 59,319,454 N2266I probably damaging Het
Krtap15 A G 16: 88,829,094 probably null Het
Lrp1 T C 10: 127,572,554 D1751G probably damaging Het
Madd A T 2: 91,162,176 D1050E probably benign Het
Man1c1 C T 4: 134,580,836 G323R probably damaging Het
Mgll A G 6: 88,823,375 E252G probably benign Het
Muc2 A G 7: 141,692,722 N145S possibly damaging Het
Ncoa2 C T 1: 13,148,375 S1410N probably benign Het
Nek10 A G 14: 14,853,965 T384A probably benign Het
Nexn T C 3: 152,247,195 E310G probably damaging Het
Nol10 T C 12: 17,402,107 L354P probably damaging Het
Npy4r T C 14: 34,146,915 R139G probably damaging Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr301 T C 7: 86,413,001 V213A probably benign Het
Olfr622 C T 7: 103,639,702 G146D probably damaging Het
Pdzd8 A T 19: 59,300,645 N774K possibly damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pot1a T C 6: 25,752,498 probably null Het
Ppip5k1 T A 2: 121,347,571 E283D probably benign Het
Ptpn2 A C 18: 67,675,792 I318R possibly damaging Het
Raph1 A G 1: 60,489,868 F745L unknown Het
Rgs19 C T 2: 181,689,748 V88I probably benign Het
Ripk4 A G 16: 97,743,249 S733P probably benign Het
Rprd1b T A 2: 158,028,979 W29R probably damaging Het
Rtkn A G 6: 83,135,962 N5S probably damaging Het
Sh3bp5l A T 11: 58,341,302 Q131L probably damaging Het
Slain2 T A 5: 72,974,548 F461I possibly damaging Het
Stk24 A T 14: 121,308,022 L108Q probably damaging Het
Syne3 TC T 12: 104,961,571 probably null Het
Tapbpl A T 6: 125,226,595 V374E probably damaging Het
Tax1bp1 A G 6: 52,721,356 I18V possibly damaging Het
Tecta T A 9: 42,387,752 I233F probably damaging Het
Tet3 A G 6: 83,404,056 S377P probably benign Het
Uty A G Y: 1,154,262 S721P probably benign Het
Wnk4 C A 11: 101,265,153 T412K possibly damaging Het
Zdhhc11 G T 13: 73,992,097 V336L probably benign Het
Zfp605 T A 5: 110,127,960 S315T probably damaging Het
Zfp746 A G 6: 48,064,877 L305P probably damaging Het
Other mutations in Olfr1062
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr1062 APN 2 86422992 missense probably damaging 0.98
IGL02638:Olfr1062 APN 2 86423677 splice site probably null
IGL02863:Olfr1062 APN 2 86423113 missense probably benign 0.44
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R1486:Olfr1062 UTSW 2 86423481 missense probably damaging 0.99
R2327:Olfr1062 UTSW 2 86422821 nonsense probably null
R3695:Olfr1062 UTSW 2 86423643 missense probably damaging 0.96
R3981:Olfr1062 UTSW 2 86422842 missense probably damaging 1.00
R4156:Olfr1062 UTSW 2 86423200 missense possibly damaging 0.67
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R5024:Olfr1062 UTSW 2 86423461 missense possibly damaging 0.77
R5351:Olfr1062 UTSW 2 86423266 missense probably damaging 1.00
R5566:Olfr1062 UTSW 2 86423377 nonsense probably null
R5777:Olfr1062 UTSW 2 86423325 missense probably benign 0.00
R6628:Olfr1062 UTSW 2 86423017 missense probably benign 0.02
R7039:Olfr1062 UTSW 2 86422833 missense possibly damaging 0.48
R7159:Olfr1062 UTSW 2 86423612 splice site probably null
R7236:Olfr1062 UTSW 2 86423189 nonsense probably null
R7575:Olfr1062 UTSW 2 86423238 missense probably benign
R7840:Olfr1062 UTSW 2 86423239 missense probably benign 0.00
R8048:Olfr1062 UTSW 2 86423307 missense probably damaging 1.00
R8167:Olfr1062 UTSW 2 86423140 missense probably damaging 1.00
R8465:Olfr1062 UTSW 2 86423631 missense probably benign 0.03
R8672:Olfr1062 UTSW 2 86423632 missense probably benign
R8871:Olfr1062 UTSW 2 86423353 missense probably benign
X0065:Olfr1062 UTSW 2 86423122 missense probably benign 0.39
Z1176:Olfr1062 UTSW 2 86423374 missense probably benign 0.07
Z1177:Olfr1062 UTSW 2 86423253 missense probably damaging 1.00
Z1177:Olfr1062 UTSW 2 86423412 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCAGCATTTTAGGAGCAATGAC -3'
(R):5'- GAAGCCTTAGTACTCTGATGTTTC -3'

Sequencing Primer
(F):5'- GCAATGACAGTGGAGTTGCC -3'
(R):5'- AAAAAGAGTAAGCATGATTGAACATG -3'
Posted On2019-06-26