Mutagenetix > Incidental Mutation

Incidental Mutation 'R7251:Igsf10'

563909

Institutional Source

Beutler Lab

Gene Symbol

Igsf10

Ensembl Gene

ENSMUSG00000036334

Gene Name

immunoglobulin superfamily, member 10

Synonyms

Adlican2, CMF608, 6530405F15Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R7251 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59316735-59344394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59319454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 2266 (N2266I)

Ref Sequence

ENSEMBL: ENSMUSP00000037246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000193455] [ENSMUST00000194546] [ENSMUST00000199659]

AlphaFold

Q3V1M1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039419
AA Change: N2266I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: N2266I

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193455
AA Change: N2266I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: N2266I

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000194546
AA Change: N2266I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: N2266I

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197374

Predicted Effect

probably benign
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (66/68)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	G	T	X: 78,370,705	M345I	probably benign	Het
Adamts19	A	T	18: 58,837,902	D186V	probably damaging	Het
Agrn	T	C	4: 156,174,606	D884G	probably damaging	Het
Akr1c6	T	A	13: 4,447,020	C154S	probably damaging	Het
Apob	T	C	12: 8,007,037	Y1840H	probably damaging	Het
Arfgef1	T	C	1: 10,198,975	E399G	possibly damaging	Het
Arg2	G	A	12: 79,150,798	G197S	probably damaging	Het
Arhgap32	T	C	9: 32,208,185	V308A	probably damaging	Het
Atcay	A	T	10: 81,210,532	C319*	probably null	Het
Bend4	C	G	5: 67,427,533	R16P	unknown	Het
Braf	A	G	6: 39,677,570		probably null	Het
Camsap1	T	C	2: 25,938,886	E942G	probably damaging	Het
Cdpf1	C	T	15: 85,809,293	G11D	probably damaging	Het
Cgn	T	C	3: 94,776,199	E382G	possibly damaging	Het
Cndp1	T	A	18: 84,622,197	E294D	probably benign	Het
Cnn1	T	A	9: 22,108,217	Y294N	unknown	Het
Cyp2ab1	A	G	16: 20,315,896	F104S	possibly damaging	Het
Cyp2t4	G	A	7: 27,157,719	V336M	possibly damaging	Het
D430041D05Rik	T	A	2: 104,221,166	D782V	probably damaging	Het
Ddx39b	A	G	17: 35,253,488	*429W	probably null	Het
Dgkb	T	C	12: 37,981,986	S16P	possibly damaging	Het
Dll4	T	C	2: 119,332,292	C465R	probably damaging	Het
Dsp	A	G	13: 38,193,548	I1770V	probably benign	Het
Fbxw11	A	G	11: 32,731,370	N250S	probably benign	Het
Fsip2	G	A	2: 82,979,081	V1915M	possibly damaging	Het
Greb1l	G	A	18: 10,515,319	V704M	probably damaging	Het
Hgf	T	A	5: 16,593,944	N323K	possibly damaging	Het
Hhatl	A	T	9: 121,785,050		probably null	Het
Hip1r	T	C	5: 123,994,750	S204P	probably damaging	Het
Krtap15	A	G	16: 88,829,094		probably null	Het
Lrp1	T	C	10: 127,572,554	D1751G	probably damaging	Het
Madd	A	T	2: 91,162,176	D1050E	probably benign	Het
Man1c1	C	T	4: 134,580,836	G323R	probably damaging	Het
Mgll	A	G	6: 88,823,375	E252G	probably benign	Het
Muc2	A	G	7: 141,692,722	N145S	possibly damaging	Het
Ncoa2	C	T	1: 13,148,375	S1410N	probably benign	Het
Nek10	A	G	14: 14,853,965	T384A	probably benign	Het
Nexn	T	C	3: 152,247,195	E310G	probably damaging	Het
Nol10	T	C	12: 17,402,107	L354P	probably damaging	Het
Npy4r	T	C	14: 34,146,915	R139G	probably damaging	Het
Nup160	A	G	2: 90,700,174	E463G	probably damaging	Het
Olfr1062	G	A	2: 86,423,596	L27F	probably benign	Het
Olfr301	T	C	7: 86,413,001	V213A	probably benign	Het
Olfr622	C	T	7: 103,639,702	G146D	probably damaging	Het
Pdzd8	A	T	19: 59,300,645	N774K	possibly damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pot1a	T	C	6: 25,752,498		probably null	Het
Ppip5k1	T	A	2: 121,347,571	E283D	probably benign	Het
Ptpn2	A	C	18: 67,675,792	I318R	possibly damaging	Het
Raph1	A	G	1: 60,489,868	F745L	unknown	Het
Rgs19	C	T	2: 181,689,748	V88I	probably benign	Het
Ripk4	A	G	16: 97,743,249	S733P	probably benign	Het
Rprd1b	T	A	2: 158,028,979	W29R	probably damaging	Het
Rtkn	A	G	6: 83,135,962	N5S	probably damaging	Het
Sh3bp5l	A	T	11: 58,341,302	Q131L	probably damaging	Het
Slain2	T	A	5: 72,974,548	F461I	possibly damaging	Het
Stk24	A	T	14: 121,308,022	L108Q	probably damaging	Het
Syne3	TC	T	12: 104,961,571		probably null	Het
Tapbpl	A	T	6: 125,226,595	V374E	probably damaging	Het
Tax1bp1	A	G	6: 52,721,356	I18V	possibly damaging	Het
Tecta	T	A	9: 42,387,752	I233F	probably damaging	Het
Tet3	A	G	6: 83,404,056	S377P	probably benign	Het
Uty	A	G	Y: 1,154,262	S721P	probably benign	Het
Wnk4	C	A	11: 101,265,153	T412K	possibly damaging	Het
Zdhhc11	G	T	13: 73,992,097	V336L	probably benign	Het
Zfp605	T	A	5: 110,127,960	S315T	probably damaging	Het
Zfp746	A	G	6: 48,064,877	L305P	probably damaging	Het

Other mutations in Igsf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Igsf10	APN	3	59331539	missense	probably benign	0.03
IGL00790:Igsf10	APN	3	59319517	missense	probably damaging	1.00
IGL00916:Igsf10	APN	3	59331127	missense	probably damaging	0.97
IGL00928:Igsf10	APN	3	59330597	missense	probably benign	0.00
IGL01066:Igsf10	APN	3	59327782	critical splice donor site	probably null
IGL01107:Igsf10	APN	3	59331524	missense	probably damaging	1.00
IGL01420:Igsf10	APN	3	59319650	missense	probably benign	0.02
IGL01533:Igsf10	APN	3	59319230	missense	probably damaging	0.98
IGL01537:Igsf10	APN	3	59330031	missense	probably benign	0.00
IGL01676:Igsf10	APN	3	59326011	missense	probably benign	0.06
IGL01676:Igsf10	APN	3	59329335	missense	probably benign	0.17
IGL01960:Igsf10	APN	3	59318737	missense	probably benign	0.00
IGL02123:Igsf10	APN	3	59318660	missense	probably damaging	0.97
IGL02198:Igsf10	APN	3	59325978	missense	possibly damaging	0.95
IGL02268:Igsf10	APN	3	59331152	nonsense	probably null
IGL02313:Igsf10	APN	3	59330690	missense	probably benign	0.01
IGL02368:Igsf10	APN	3	59328231	missense	probably benign
IGL02494:Igsf10	APN	3	59328006	missense	probably damaging	0.98
IGL02549:Igsf10	APN	3	59329241	missense	probably benign	0.03
IGL02616:Igsf10	APN	3	59318606	missense	probably benign	0.06
IGL02957:Igsf10	APN	3	59330864	missense	probably damaging	1.00
IGL03067:Igsf10	APN	3	59318918	missense	probably benign	0.25
IGL03104:Igsf10	APN	3	59319484	missense	probably damaging	1.00
IGL03124:Igsf10	APN	3	59319665	missense	probably benign	0.01
IGL03212:Igsf10	APN	3	59328165	missense	probably benign	0.09
IGL03347:Igsf10	APN	3	59331900	missense	possibly damaging	0.94
IGL03357:Igsf10	APN	3	59336211	missense	probably benign	0.35
F6893:Igsf10	UTSW	3	59331060	missense	probably damaging	1.00
FR4449:Igsf10	UTSW	3	59319110	missense	probably damaging	1.00
PIT1430001:Igsf10	UTSW	3	59328158	missense	probably benign	0.06
PIT4402001:Igsf10	UTSW	3	59325579	missense	probably benign	0.00
PIT4810001:Igsf10	UTSW	3	59318482	missense	probably damaging	1.00
R0068:Igsf10	UTSW	3	59330624	missense	probably damaging	0.98
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0112:Igsf10	UTSW	3	59326008	missense	probably benign	0.00
R0141:Igsf10	UTSW	3	59330832	missense	probably damaging	1.00
R0538:Igsf10	UTSW	3	59320106	missense	probably damaging	0.99
R0551:Igsf10	UTSW	3	59328668	missense	probably benign	0.01
R0556:Igsf10	UTSW	3	59328875	missense	probably benign	0.02
R0582:Igsf10	UTSW	3	59319767	missense	probably benign	0.00
R0630:Igsf10	UTSW	3	59326062	missense	probably damaging	1.00
R0675:Igsf10	UTSW	3	59328594	missense	probably benign	0.14
R0948:Igsf10	UTSW	3	59331104	missense	probably damaging	1.00
R1252:Igsf10	UTSW	3	59331848	missense	probably benign	0.03
R1412:Igsf10	UTSW	3	59327775	splice site	probably benign
R1473:Igsf10	UTSW	3	59318767	missense	probably damaging	1.00
R1585:Igsf10	UTSW	3	59330417	missense	probably damaging	1.00
R1650:Igsf10	UTSW	3	59326162	missense	probably damaging	1.00
R1660:Igsf10	UTSW	3	59331285	missense	probably damaging	1.00
R1671:Igsf10	UTSW	3	59328500	nonsense	probably null
R1748:Igsf10	UTSW	3	59319093	missense	probably damaging	1.00
R1758:Igsf10	UTSW	3	59329196	missense	probably benign	0.09
R1856:Igsf10	UTSW	3	59331272	missense	possibly damaging	0.63
R1912:Igsf10	UTSW	3	59329572	missense	probably benign	0.40
R2148:Igsf10	UTSW	3	59336577	missense	possibly damaging	0.77
R2155:Igsf10	UTSW	3	59331680	missense	probably damaging	1.00
R2509:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2511:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2680:Igsf10	UTSW	3	59325454	missense	probably benign	0.14
R2913:Igsf10	UTSW	3	59331736	missense	possibly damaging	0.70
R2927:Igsf10	UTSW	3	59329427	missense	probably benign
R3547:Igsf10	UTSW	3	59330541	missense	probably benign	0.02
R3547:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3548:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3620:Igsf10	UTSW	3	59336331	missense	probably damaging	1.00
R3732:Igsf10	UTSW	3	59325714	missense	probably benign	0.29
R3743:Igsf10	UTSW	3	59326125	missense	possibly damaging	0.69
R3973:Igsf10	UTSW	3	59331924	missense	probably damaging	1.00
R4005:Igsf10	UTSW	3	59328560	missense	probably benign	0.00
R4184:Igsf10	UTSW	3	59319731	missense	probably damaging	1.00
R4302:Igsf10	UTSW	3	59318750	missense	probably damaging	1.00
R4404:Igsf10	UTSW	3	59329551	missense	probably benign	0.04
R4575:Igsf10	UTSW	3	59330100	missense	probably benign
R4676:Igsf10	UTSW	3	59325949	missense	probably benign	0.23
R4700:Igsf10	UTSW	3	59320330	missense	probably damaging	0.99
R4765:Igsf10	UTSW	3	59329705	missense	probably benign	0.01
R4986:Igsf10	UTSW	3	59328606	missense	probably benign	0.24
R5012:Igsf10	UTSW	3	59318722	missense	probably damaging	1.00
R5070:Igsf10	UTSW	3	59328293	missense	probably benign	0.02
R5083:Igsf10	UTSW	3	59326273	missense	probably damaging	1.00
R5336:Igsf10	UTSW	3	59320132	missense	probably damaging	1.00
R5462:Igsf10	UTSW	3	59325754	missense	probably damaging	1.00
R5648:Igsf10	UTSW	3	59328153	missense	probably benign	0.01
R5810:Igsf10	UTSW	3	59319071	missense	probably damaging	1.00
R5871:Igsf10	UTSW	3	59330411	missense	possibly damaging	0.83
R5880:Igsf10	UTSW	3	59330831	missense	probably damaging	1.00
R5935:Igsf10	UTSW	3	59328157	missense	probably benign	0.12
R5979:Igsf10	UTSW	3	59336473	missense	probably damaging	1.00
R6145:Igsf10	UTSW	3	59331656	missense	possibly damaging	0.83
R6222:Igsf10	UTSW	3	59318915	missense	possibly damaging	0.90
R6224:Igsf10	UTSW	3	59325510	missense	probably damaging	1.00
R6264:Igsf10	UTSW	3	59328507	missense	possibly damaging	0.88
R6283:Igsf10	UTSW	3	59319449	missense	probably damaging	1.00
R6336:Igsf10	UTSW	3	59330339	missense	probably benign	0.00
R6490:Igsf10	UTSW	3	59329571	missense	probably benign	0.06
R6785:Igsf10	UTSW	3	59319244	missense	probably damaging	1.00
R6873:Igsf10	UTSW	3	59328444	missense	probably benign
R6889:Igsf10	UTSW	3	59331933	missense	probably benign
R7024:Igsf10	UTSW	3	59331701	missense	probably benign	0.00
R7056:Igsf10	UTSW	3	59331080	missense	probably damaging	1.00
R7128:Igsf10	UTSW	3	59328905	missense	probably benign
R7313:Igsf10	UTSW	3	59329416	missense	probably benign	0.05
R7340:Igsf10	UTSW	3	59325768	missense	probably damaging	1.00
R7447:Igsf10	UTSW	3	59331801	missense	probably benign	0.39
R7506:Igsf10	UTSW	3	59319354	missense	probably damaging	1.00
R7678:Igsf10	UTSW	3	59319340	missense	possibly damaging	0.81
R7695:Igsf10	UTSW	3	59326191	missense	probably damaging	1.00
R7709:Igsf10	UTSW	3	59331543	missense	probably damaging	0.96
R7749:Igsf10	UTSW	3	59329128	missense	possibly damaging	0.88
R7808:Igsf10	UTSW	3	59328068	missense	probably benign	0.00
R7850:Igsf10	UTSW	3	59319632	missense	probably benign	0.33
R7879:Igsf10	UTSW	3	59330724	missense	probably damaging	1.00
R7886:Igsf10	UTSW	3	59328327	missense	probably benign	0.01
R7891:Igsf10	UTSW	3	59328411	nonsense	probably null
R7946:Igsf10	UTSW	3	59319704	missense	possibly damaging	0.69
R7948:Igsf10	UTSW	3	59331858	missense	probably benign	0.02
R8004:Igsf10	UTSW	3	59329709	missense	probably benign	0.01
R8096:Igsf10	UTSW	3	59328959	missense	probably damaging	0.98
R8141:Igsf10	UTSW	3	59330528	missense	probably damaging	0.96
R8183:Igsf10	UTSW	3	59330615	missense	probably benign	0.04
R8203:Igsf10	UTSW	3	59328833	missense	probably benign	0.11
R8325:Igsf10	UTSW	3	59318533	missense	probably damaging	0.96
R8350:Igsf10	UTSW	3	59331528	missense	probably damaging	1.00
R8387:Igsf10	UTSW	3	59329143	missense	probably damaging	1.00
R8488:Igsf10	UTSW	3	59320010	missense	probably damaging	1.00
R8697:Igsf10	UTSW	3	59318887	missense	probably benign	0.02
R8786:Igsf10	UTSW	3	59330642	missense	probably benign	0.25
R8804:Igsf10	UTSW	3	59336455	missense	probably damaging	1.00
R8886:Igsf10	UTSW	3	59329989	missense	probably benign	0.00
R8902:Igsf10	UTSW	3	59336212	missense	probably benign	0.00
R8906:Igsf10	UTSW	3	59326318	missense	probably benign	0.01
R8917:Igsf10	UTSW	3	59319467	missense	possibly damaging	0.69
R9051:Igsf10	UTSW	3	59329247	missense	probably benign	0.00
R9178:Igsf10	UTSW	3	59326059	missense	possibly damaging	0.69
R9228:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9230:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9231:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9232:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9417:Igsf10	UTSW	3	59329105	missense	possibly damaging	0.94
R9609:Igsf10	UTSW	3	59319448	missense	probably damaging	1.00
R9631:Igsf10	UTSW	3	59330483	missense	probably damaging	1.00
R9689:Igsf10	UTSW	3	59326203	missense	probably damaging	1.00
R9762:Igsf10	UTSW	3	59329685	missense	probably damaging	1.00
R9770:Igsf10	UTSW	3	59319778	missense	probably benign	0.07
R9798:Igsf10	UTSW	3	59331705	missense	probably damaging	1.00
Z1088:Igsf10	UTSW	3	59329938	missense	possibly damaging	0.59
Z1177:Igsf10	UTSW	3	59329605	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTGGGTTCCCATCCACAGAG -3'
(R):5'- TCTCTAGGCCTCCATTAATCAATG -3'

Sequencing Primer
(F):5'- ATTGCTACAGGCTTGCCAAC -3'
(R):5'- TAAAGCCACAGCCATTCAG -3'

Posted On

2019-06-26