Incidental Mutation 'R0580:Or6b6'
ID 56392
Institutional Source Beutler Lab
Gene Symbol Or6b6
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor family 6 subfamily B member 6
Synonyms MOR103-4, Olfr711, GA_x6K02T2PBJ9-9352783-9351839
MMRRC Submission 038770-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R0580 (G1)
Quality Score 181
Status Validated
Chromosome 7
Chromosomal Location 106570575-106574658 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106571447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000149016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably damaging
Transcript: ENSMUST00000051715
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207200
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216335
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6508 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T A 3: 59,784,470 (GRCm39) D314E probably damaging Het
Abcc10 C T 17: 46,616,882 (GRCm39) probably null Het
Adgrg5 T C 8: 95,663,972 (GRCm39) probably null Het
Akap12 A T 10: 4,304,741 (GRCm39) D517V possibly damaging Het
Arhgap23 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 97,337,362 (GRCm39) probably null Het
Bpi A T 2: 158,100,215 (GRCm39) M1L probably damaging Het
Carm1 C T 9: 21,494,880 (GRCm39) P339S probably damaging Het
Chchd3 A C 6: 32,870,325 (GRCm39) probably null Het
Chd9 T C 8: 91,721,191 (GRCm39) V520A possibly damaging Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Col10a1 A G 10: 34,270,948 (GRCm39) R307G probably benign Het
Cpeb3 T C 19: 37,151,435 (GRCm39) T314A probably benign Het
Csmd1 A T 8: 15,960,528 (GRCm39) Y3296N probably damaging Het
Dtx2 A T 5: 136,061,180 (GRCm39) T521S probably damaging Het
Ext2 A T 2: 93,626,070 (GRCm39) V330E probably benign Het
Extl3 A G 14: 65,313,178 (GRCm39) L668P probably damaging Het
Gm6605 C A 7: 38,147,699 (GRCm39) noncoding transcript Het
Grm8 A G 6: 27,761,370 (GRCm39) probably benign Het
Herc2 T A 7: 55,788,539 (GRCm39) V1763D probably damaging Het
Ino80 G A 2: 119,213,962 (GRCm39) P1203S probably damaging Het
Iqce A G 5: 140,651,156 (GRCm39) F768L possibly damaging Het
Kntc1 G A 5: 123,941,732 (GRCm39) V1809I probably benign Het
Lyzl1 A C 18: 4,181,134 (GRCm39) T58P probably damaging Het
Mlxipl A G 5: 135,152,829 (GRCm39) T287A probably benign Het
Mroh2a G A 1: 88,171,672 (GRCm39) R770Q probably damaging Het
Net1 A G 13: 3,936,612 (GRCm39) Y264H probably damaging Het
Nnmt T C 9: 48,503,600 (GRCm39) D142G probably damaging Het
Nod2 T A 8: 89,391,034 (GRCm39) I432N probably damaging Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or2y1g T A 11: 49,171,449 (GRCm39) I158N probably damaging Het
Pign A C 1: 105,519,419 (GRCm39) I501S probably benign Het
Scgb2b19 A T 7: 32,977,995 (GRCm39) S101T probably benign Het
Slc7a5 A T 8: 122,611,855 (GRCm39) M391K probably benign Het
Sptan1 A G 2: 29,897,587 (GRCm39) R1217G probably damaging Het
Srgap2 A G 1: 131,277,239 (GRCm39) V336A possibly damaging Het
Srsf11 C T 3: 157,717,704 (GRCm39) probably benign Het
Syt10 A T 15: 89,711,379 (GRCm39) D51E probably benign Het
Vmn2r96 T C 17: 18,802,900 (GRCm39) V270A probably damaging Het
Other mutations in Or6b6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Or6b6 APN 7 106,570,756 (GRCm39) missense possibly damaging 0.51
R0087:Or6b6 UTSW 7 106,571,323 (GRCm39) missense probably benign 0.01
R1375:Or6b6 UTSW 7 106,571,305 (GRCm39) missense probably damaging 1.00
R1538:Or6b6 UTSW 7 106,571,190 (GRCm39) nonsense probably null
R1875:Or6b6 UTSW 7 106,571,389 (GRCm39) missense possibly damaging 0.86
R2156:Or6b6 UTSW 7 106,570,775 (GRCm39) missense probably damaging 1.00
R4290:Or6b6 UTSW 7 106,570,918 (GRCm39) missense probably damaging 0.97
R4332:Or6b6 UTSW 7 106,571,354 (GRCm39) missense probably benign 0.00
R4400:Or6b6 UTSW 7 106,571,209 (GRCm39) missense probably damaging 1.00
R4688:Or6b6 UTSW 7 106,571,068 (GRCm39) missense probably benign 0.02
R4868:Or6b6 UTSW 7 106,570,974 (GRCm39) missense probably benign
R4970:Or6b6 UTSW 7 106,570,778 (GRCm39) missense probably benign 0.35
R5006:Or6b6 UTSW 7 106,570,808 (GRCm39) missense probably damaging 1.00
R5082:Or6b6 UTSW 7 106,570,871 (GRCm39) missense probably benign 0.00
R5121:Or6b6 UTSW 7 106,571,438 (GRCm39) missense probably benign
R6465:Or6b6 UTSW 7 106,571,419 (GRCm39) missense possibly damaging 0.63
R6541:Or6b6 UTSW 7 106,571,410 (GRCm39) missense probably benign 0.20
R7419:Or6b6 UTSW 7 106,571,353 (GRCm39) missense probably benign 0.01
R8048:Or6b6 UTSW 7 106,571,671 (GRCm39) start gained probably benign
R9310:Or6b6 UTSW 7 106,570,678 (GRCm39) missense probably damaging 1.00
R9470:Or6b6 UTSW 7 106,571,461 (GRCm39) missense probably benign 0.26
R9603:Or6b6 UTSW 7 106,571,103 (GRCm39) nonsense probably null
Z1177:Or6b6 UTSW 7 106,571,122 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACATTGGAGCCACAGAAAGCAAC -3'
(R):5'- GGTCTGATGCCATAGACATTGCCC -3'

Sequencing Primer
(F):5'- CTGAGTCATACAGCCTGTGAAG -3'
(R):5'- GATGCCATAGACATTGCCCTTATTTG -3'
Posted On 2013-07-11