Incidental Mutation 'R7251:Tapbpl'
ID563925
Institutional Source Beutler Lab
Gene Symbol Tapbpl
Ensembl Gene ENSMUSG00000038213
Gene NameTAP binding protein-like
SynonymsTAPBPL-R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7251 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125223933-125231860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125226595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 374 (V374E)
Ref Sequence ENSEMBL: ENSMUSP00000047105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032487] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000100942]
Predicted Effect probably benign
Transcript: ENSMUST00000032487
SMART Domains Protein: ENSMUSP00000032487
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 1.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043422
AA Change: V374E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213
AA Change: V374E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 202 306 1.11e-5 SMART
IGc1 321 397 3.97e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100942
SMART Domains Protein: ENSMUSP00000098503
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 116 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205223
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tapasin, or TAPBP (MIM 601962), is a member of the variable-constant Ig superfamily that links major histocompatibility complex (MHC) class I molecules to the transporter associated with antigen processing (TAP; see MIM 170260) in the endoplasmic reticulum (ER). The TAPBP gene is located near the MHC complex on chromosome 6p21.3. TAPBPL is a member of the Ig superfamily that is localized on chromosome 12p13.3, a region somewhat paralogous to the MHC.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Adamts19 A T 18: 58,837,902 D186V probably damaging Het
Agrn T C 4: 156,174,606 D884G probably damaging Het
Akr1c6 T A 13: 4,447,020 C154S probably damaging Het
Apob T C 12: 8,007,037 Y1840H probably damaging Het
Arfgef1 T C 1: 10,198,975 E399G possibly damaging Het
Arg2 G A 12: 79,150,798 G197S probably damaging Het
Arhgap32 T C 9: 32,208,185 V308A probably damaging Het
Atcay A T 10: 81,210,532 C319* probably null Het
Bend4 C G 5: 67,427,533 R16P unknown Het
Braf A G 6: 39,677,570 probably null Het
Camsap1 T C 2: 25,938,886 E942G probably damaging Het
Cdpf1 C T 15: 85,809,293 G11D probably damaging Het
Cgn T C 3: 94,776,199 E382G possibly damaging Het
Cndp1 T A 18: 84,622,197 E294D probably benign Het
Cnn1 T A 9: 22,108,217 Y294N unknown Het
Cyp2ab1 A G 16: 20,315,896 F104S possibly damaging Het
Cyp2t4 G A 7: 27,157,719 V336M possibly damaging Het
D430041D05Rik T A 2: 104,221,166 D782V probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dgkb T C 12: 37,981,986 S16P possibly damaging Het
Dll4 T C 2: 119,332,292 C465R probably damaging Het
Dsp A G 13: 38,193,548 I1770V probably benign Het
Fbxw11 A G 11: 32,731,370 N250S probably benign Het
Fsip2 G A 2: 82,979,081 V1915M possibly damaging Het
Greb1l G A 18: 10,515,319 V704M probably damaging Het
Hgf T A 5: 16,593,944 N323K possibly damaging Het
Hhatl A T 9: 121,785,050 probably null Het
Hip1r T C 5: 123,994,750 S204P probably damaging Het
Igsf10 T A 3: 59,319,454 N2266I probably damaging Het
Krtap15 A G 16: 88,829,094 probably null Het
Lrp1 T C 10: 127,572,554 D1751G probably damaging Het
Madd A T 2: 91,162,176 D1050E probably benign Het
Man1c1 C T 4: 134,580,836 G323R probably damaging Het
Mgll A G 6: 88,823,375 E252G probably benign Het
Muc2 A G 7: 141,692,722 N145S possibly damaging Het
Ncoa2 C T 1: 13,148,375 S1410N probably benign Het
Nek10 A G 14: 14,853,965 T384A probably benign Het
Nexn T C 3: 152,247,195 E310G probably damaging Het
Nol10 T C 12: 17,402,107 L354P probably damaging Het
Npy4r T C 14: 34,146,915 R139G probably damaging Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1062 G A 2: 86,423,596 L27F probably benign Het
Olfr301 T C 7: 86,413,001 V213A probably benign Het
Olfr622 C T 7: 103,639,702 G146D probably damaging Het
Pdzd8 A T 19: 59,300,645 N774K possibly damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pot1a T C 6: 25,752,498 probably null Het
Ppip5k1 T A 2: 121,347,571 E283D probably benign Het
Ptpn2 A C 18: 67,675,792 I318R possibly damaging Het
Raph1 A G 1: 60,489,868 F745L unknown Het
Rgs19 C T 2: 181,689,748 V88I probably benign Het
Ripk4 A G 16: 97,743,249 S733P probably benign Het
Rprd1b T A 2: 158,028,979 W29R probably damaging Het
Rtkn A G 6: 83,135,962 N5S probably damaging Het
Sh3bp5l A T 11: 58,341,302 Q131L probably damaging Het
Slain2 T A 5: 72,974,548 F461I possibly damaging Het
Stk24 A T 14: 121,308,022 L108Q probably damaging Het
Syne3 TC T 12: 104,961,571 probably null Het
Tax1bp1 A G 6: 52,721,356 I18V possibly damaging Het
Tecta T A 9: 42,387,752 I233F probably damaging Het
Tet3 A G 6: 83,404,056 S377P probably benign Het
Uty A G Y: 1,154,262 S721P probably benign Het
Wnk4 C A 11: 101,265,153 T412K possibly damaging Het
Zdhhc11 G T 13: 73,992,097 V336L probably benign Het
Zfp605 T A 5: 110,127,960 S315T probably damaging Het
Zfp746 A G 6: 48,064,877 L305P probably damaging Het
Other mutations in Tapbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03083:Tapbpl APN 6 125228228 unclassified probably null
IGL03308:Tapbpl APN 6 125228179 missense possibly damaging 0.93
R1666:Tapbpl UTSW 6 125230201 missense probably benign 0.00
R3707:Tapbpl UTSW 6 125224695 unclassified probably null
R4521:Tapbpl UTSW 6 125228122 missense probably damaging 1.00
R4744:Tapbpl UTSW 6 125228285 missense probably damaging 1.00
R6290:Tapbpl UTSW 6 125230716 missense probably benign 0.00
R6328:Tapbpl UTSW 6 125224918 missense probably benign 0.40
R6565:Tapbpl UTSW 6 125228344 missense probably benign 0.00
R7085:Tapbpl UTSW 6 125226488 splice site probably null
X0026:Tapbpl UTSW 6 125230570 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGATGCCACTCTGGGAAAG -3'
(R):5'- AACAAGGATCCTCTGCCTTCC -3'

Sequencing Primer
(F):5'- ACAGCCAAAGATGACCTGTAAG -3'
(R):5'- CCCTCGTCTGCAGCATTG -3'
Posted On2019-06-26