Mutagenetix > Incidental Mutation

Incidental Mutation 'R7251:Adamts19'

563955

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7251 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58837902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 186 (D186V)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: D186V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: D186V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	G	T	X: 78,370,705	M345I	probably benign	Het
Agrn	T	C	4: 156,174,606	D884G	probably damaging	Het
Akr1c6	T	A	13: 4,447,020	C154S	probably damaging	Het
Apob	T	C	12: 8,007,037	Y1840H	probably damaging	Het
Arfgef1	T	C	1: 10,198,975	E399G	possibly damaging	Het
Arg2	G	A	12: 79,150,798	G197S	probably damaging	Het
Arhgap32	T	C	9: 32,208,185	V308A	probably damaging	Het
Atcay	A	T	10: 81,210,532	C319*	probably null	Het
Bend4	C	G	5: 67,427,533	R16P	unknown	Het
Braf	A	G	6: 39,677,570		probably null	Het
Camsap1	T	C	2: 25,938,886	E942G	probably damaging	Het
Cdpf1	C	T	15: 85,809,293	G11D	probably damaging	Het
Cgn	T	C	3: 94,776,199	E382G	possibly damaging	Het
Cndp1	T	A	18: 84,622,197	E294D	probably benign	Het
Cnn1	T	A	9: 22,108,217	Y294N	unknown	Het
Cyp2ab1	A	G	16: 20,315,896	F104S	possibly damaging	Het
Cyp2t4	G	A	7: 27,157,719	V336M	possibly damaging	Het
D430041D05Rik	T	A	2: 104,221,166	D782V	probably damaging	Het
Ddx39b	A	G	17: 35,253,488	*429W	probably null	Het
Dgkb	T	C	12: 37,981,986	S16P	possibly damaging	Het
Dll4	T	C	2: 119,332,292	C465R	probably damaging	Het
Dsp	A	G	13: 38,193,548	I1770V	probably benign	Het
Fbxw11	A	G	11: 32,731,370	N250S	probably benign	Het
Fsip2	G	A	2: 82,979,081	V1915M	possibly damaging	Het
Greb1l	G	A	18: 10,515,319	V704M	probably damaging	Het
Hgf	T	A	5: 16,593,944	N323K	possibly damaging	Het
Hhatl	A	T	9: 121,785,050		probably null	Het
Hip1r	T	C	5: 123,994,750	S204P	probably damaging	Het
Igsf10	T	A	3: 59,319,454	N2266I	probably damaging	Het
Krtap15	A	G	16: 88,829,094		probably null	Het
Lrp1	T	C	10: 127,572,554	D1751G	probably damaging	Het
Madd	A	T	2: 91,162,176	D1050E	probably benign	Het
Man1c1	C	T	4: 134,580,836	G323R	probably damaging	Het
Mgll	A	G	6: 88,823,375	E252G	probably benign	Het
Muc2	A	G	7: 141,692,722	N145S	possibly damaging	Het
Ncoa2	C	T	1: 13,148,375	S1410N	probably benign	Het
Nek10	A	G	14: 14,853,965	T384A	probably benign	Het
Nexn	T	C	3: 152,247,195	E310G	probably damaging	Het
Nol10	T	C	12: 17,402,107	L354P	probably damaging	Het
Npy4r	T	C	14: 34,146,915	R139G	probably damaging	Het
Nup160	A	G	2: 90,700,174	E463G	probably damaging	Het
Olfr1062	G	A	2: 86,423,596	L27F	probably benign	Het
Olfr301	T	C	7: 86,413,001	V213A	probably benign	Het
Olfr622	C	T	7: 103,639,702	G146D	probably damaging	Het
Pdzd8	A	T	19: 59,300,645	N774K	possibly damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pot1a	T	C	6: 25,752,498		probably null	Het
Ppip5k1	T	A	2: 121,347,571	E283D	probably benign	Het
Ptpn2	A	C	18: 67,675,792	I318R	possibly damaging	Het
Raph1	A	G	1: 60,489,868	F745L	unknown	Het
Rgs19	C	T	2: 181,689,748	V88I	probably benign	Het
Ripk4	A	G	16: 97,743,249	S733P	probably benign	Het
Rprd1b	T	A	2: 158,028,979	W29R	probably damaging	Het
Rtkn	A	G	6: 83,135,962	N5S	probably damaging	Het
Sh3bp5l	A	T	11: 58,341,302	Q131L	probably damaging	Het
Slain2	T	A	5: 72,974,548	F461I	possibly damaging	Het
Stk24	A	T	14: 121,308,022	L108Q	probably damaging	Het
Syne3	TC	T	12: 104,961,571		probably null	Het
Tapbpl	A	T	6: 125,226,595	V374E	probably damaging	Het
Tax1bp1	A	G	6: 52,721,356	I18V	possibly damaging	Het
Tecta	T	A	9: 42,387,752	I233F	probably damaging	Het
Tet3	A	G	6: 83,404,056	S377P	probably benign	Het
Uty	A	G	Y: 1,154,262	S721P	probably benign	Het
Wnk4	C	A	11: 101,265,153	T412K	possibly damaging	Het
Zdhhc11	G	T	13: 73,992,097	V336L	probably benign	Het
Zfp605	T	A	5: 110,127,960	S315T	probably damaging	Het
Zfp746	A	G	6: 48,064,877	L305P	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ACTCGAATCTCAGGAGCTGC -3'
(R):5'- AGAGCTGTGGATGCTTACCAG -3'

Sequencing Primer
(F):5'- AATCTCAGGAGCTGCCTCGG -3'
(R):5'- TGTGGATGCTTACCAGGCCAC -3'

Posted On

2019-06-26