Incidental Mutation 'R7251:Uty'
ID563960
Institutional Source Beutler Lab
Gene Symbol Uty
Ensembl Gene ENSMUSG00000068457
Gene Nameubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
SynonymsHydb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7251 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location1096861-1245759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 1154262 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 721 (S721P)
Ref Sequence ENSEMBL: ENSMUSP00000070012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069309] [ENSMUST00000137048] [ENSMUST00000139365] [ENSMUST00000143286] [ENSMUST00000143958] [ENSMUST00000154004] [ENSMUST00000154666]
Predicted Effect probably benign
Transcript: ENSMUST00000069309
AA Change: S721P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070012
Gene: ENSMUSG00000068457
AA Change: S721P

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 88 121 1.51e1 SMART
TPR 125 158 2.26e-3 SMART
TPR 200 233 2.31e0 SMART
TPR 279 312 6.19e-1 SMART
TPR 313 346 4.21e-3 SMART
TPR 347 380 8.97e0 SMART
Blast:JmjC 389 470 2e-28 BLAST
low complexity region 534 551 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 784 795 N/A INTRINSIC
JmjC 907 1070 5.22e-47 SMART
Blast:JmjC 1106 1170 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137048
SMART Domains Protein: ENSMUSP00000119406
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 85 118 1.51e1 SMART
TPR 122 155 2.26e-3 SMART
TPR 197 230 2.31e0 SMART
TPR 276 309 6.19e-1 SMART
TPR 310 343 4.21e-3 SMART
TPR 344 377 8.97e0 SMART
Blast:JmjC 452 647 6e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139365
AA Change: S720P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114752
Gene: ENSMUSG00000068457
AA Change: S720P

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 87 120 1.51e1 SMART
TPR 124 157 2.26e-3 SMART
TPR 199 232 2.31e0 SMART
TPR 278 311 6.19e-1 SMART
TPR 312 345 4.21e-3 SMART
TPR 346 379 8.97e0 SMART
Blast:JmjC 388 469 2e-28 BLAST
low complexity region 533 550 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
JmjC 906 1069 5.22e-47 SMART
Blast:JmjC 1105 1169 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143286
AA Change: S620P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115113
Gene: ENSMUSG00000068457
AA Change: S620P

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 69 102 2.26e-3 SMART
TPR 144 177 2.31e0 SMART
TPR 223 256 6.19e-1 SMART
TPR 257 290 4.21e-3 SMART
TPR 291 324 8.97e0 SMART
low complexity region 433 450 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 683 694 N/A INTRINSIC
JmjC 806 969 5.22e-47 SMART
Blast:JmjC 1005 1069 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143958
SMART Domains Protein: ENSMUSP00000120069
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154004
AA Change: S658P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114910
Gene: ENSMUSG00000068457
AA Change: S658P

DomainStartEndE-ValueType
TPR 25 58 1.51e1 SMART
TPR 62 95 2.26e-3 SMART
TPR 137 170 2.31e0 SMART
TPR 216 249 6.19e-1 SMART
TPR 250 283 4.21e-3 SMART
TPR 284 317 8.97e0 SMART
Blast:JmjC 326 407 2e-28 BLAST
low complexity region 471 488 N/A INTRINSIC
low complexity region 568 583 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 668 681 N/A INTRINSIC
low complexity region 721 732 N/A INTRINSIC
JmjC 844 1007 5.22e-47 SMART
Blast:JmjC 1043 1107 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154666
SMART Domains Protein: ENSMUSP00000122818
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mutant male mice hemizygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Adamts19 A T 18: 58,837,902 D186V probably damaging Het
Agrn T C 4: 156,174,606 D884G probably damaging Het
Akr1c6 T A 13: 4,447,020 C154S probably damaging Het
Apob T C 12: 8,007,037 Y1840H probably damaging Het
Arfgef1 T C 1: 10,198,975 E399G possibly damaging Het
Arg2 G A 12: 79,150,798 G197S probably damaging Het
Arhgap32 T C 9: 32,208,185 V308A probably damaging Het
Atcay A T 10: 81,210,532 C319* probably null Het
Bend4 C G 5: 67,427,533 R16P unknown Het
Braf A G 6: 39,677,570 probably null Het
Camsap1 T C 2: 25,938,886 E942G probably damaging Het
Cdpf1 C T 15: 85,809,293 G11D probably damaging Het
Cgn T C 3: 94,776,199 E382G possibly damaging Het
Cndp1 T A 18: 84,622,197 E294D probably benign Het
Cnn1 T A 9: 22,108,217 Y294N unknown Het
Cyp2ab1 A G 16: 20,315,896 F104S possibly damaging Het
Cyp2t4 G A 7: 27,157,719 V336M possibly damaging Het
D430041D05Rik T A 2: 104,221,166 D782V probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dgkb T C 12: 37,981,986 S16P possibly damaging Het
Dll4 T C 2: 119,332,292 C465R probably damaging Het
Dsp A G 13: 38,193,548 I1770V probably benign Het
Fbxw11 A G 11: 32,731,370 N250S probably benign Het
Fsip2 G A 2: 82,979,081 V1915M possibly damaging Het
Greb1l G A 18: 10,515,319 V704M probably damaging Het
Hgf T A 5: 16,593,944 N323K possibly damaging Het
Hhatl A T 9: 121,785,050 probably null Het
Hip1r T C 5: 123,994,750 S204P probably damaging Het
Igsf10 T A 3: 59,319,454 N2266I probably damaging Het
Krtap15 A G 16: 88,829,094 probably null Het
Lrp1 T C 10: 127,572,554 D1751G probably damaging Het
Madd A T 2: 91,162,176 D1050E probably benign Het
Man1c1 C T 4: 134,580,836 G323R probably damaging Het
Mgll A G 6: 88,823,375 E252G probably benign Het
Muc2 A G 7: 141,692,722 N145S possibly damaging Het
Ncoa2 C T 1: 13,148,375 S1410N probably benign Het
Nek10 A G 14: 14,853,965 T384A probably benign Het
Nexn T C 3: 152,247,195 E310G probably damaging Het
Nol10 T C 12: 17,402,107 L354P probably damaging Het
Npy4r T C 14: 34,146,915 R139G probably damaging Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1062 G A 2: 86,423,596 L27F probably benign Het
Olfr301 T C 7: 86,413,001 V213A probably benign Het
Olfr622 C T 7: 103,639,702 G146D probably damaging Het
Pdzd8 A T 19: 59,300,645 N774K possibly damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pot1a T C 6: 25,752,498 probably null Het
Ppip5k1 T A 2: 121,347,571 E283D probably benign Het
Ptpn2 A C 18: 67,675,792 I318R possibly damaging Het
Raph1 A G 1: 60,489,868 F745L unknown Het
Rgs19 C T 2: 181,689,748 V88I probably benign Het
Ripk4 A G 16: 97,743,249 S733P probably benign Het
Rprd1b T A 2: 158,028,979 W29R probably damaging Het
Rtkn A G 6: 83,135,962 N5S probably damaging Het
Sh3bp5l A T 11: 58,341,302 Q131L probably damaging Het
Slain2 T A 5: 72,974,548 F461I possibly damaging Het
Stk24 A T 14: 121,308,022 L108Q probably damaging Het
Syne3 TC T 12: 104,961,571 probably null Het
Tapbpl A T 6: 125,226,595 V374E probably damaging Het
Tax1bp1 A G 6: 52,721,356 I18V possibly damaging Het
Tecta T A 9: 42,387,752 I233F probably damaging Het
Tet3 A G 6: 83,404,056 S377P probably benign Het
Wnk4 C A 11: 101,265,153 T412K possibly damaging Het
Zdhhc11 G T 13: 73,992,097 V336L probably benign Het
Zfp605 T A 5: 110,127,960 S315T probably damaging Het
Zfp746 A G 6: 48,064,877 L305P probably damaging Het
Other mutations in Uty
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Uty UTSW Y 1197223 missense probably damaging 1.00
R0277:Uty UTSW Y 1169979 missense probably damaging 1.00
R0323:Uty UTSW Y 1169979 missense probably damaging 1.00
R1102:Uty UTSW Y 1174741 missense probably damaging 1.00
R1256:Uty UTSW Y 1134884 missense probably damaging 0.96
R1499:Uty UTSW Y 1197228 missense probably damaging 1.00
R1534:Uty UTSW Y 1245440 missense probably benign 0.41
R1643:Uty UTSW Y 1152054 missense probably damaging 1.00
R2070:Uty UTSW Y 1169193 missense probably benign 0.28
R2101:Uty UTSW Y 1176541 missense probably damaging 0.99
R2146:Uty UTSW Y 1239816 missense probably benign 0.25
R2508:Uty UTSW Y 1158182 missense probably damaging 1.00
R3036:Uty UTSW Y 1099671 nonsense probably null
R3437:Uty UTSW Y 1158336 missense probably benign 0.38
R3547:Uty UTSW Y 1158512 missense possibly damaging 0.78
R4153:Uty UTSW Y 1158327 missense possibly damaging 0.68
R4388:Uty UTSW Y 1151956 missense possibly damaging 0.94
R4467:Uty UTSW Y 1158372 missense possibly damaging 0.48
R4607:Uty UTSW Y 1131134 missense probably damaging 1.00
R4608:Uty UTSW Y 1131134 missense probably damaging 1.00
R4684:Uty UTSW Y 1176502 nonsense probably null
R4948:Uty UTSW Y 1136883 missense probably damaging 1.00
R5129:Uty UTSW Y 1158592 missense probably benign 0.13
R5387:Uty UTSW Y 1189339 missense probably damaging 1.00
R5408:Uty UTSW Y 1245614 missense possibly damaging 0.46
R5487:Uty UTSW Y 1174825 missense probably damaging 1.00
R5677:Uty UTSW Y 1134902 missense probably damaging 1.00
R5806:Uty UTSW Y 1170921 missense probably damaging 0.99
R6047:Uty UTSW Y 1158288 missense probably damaging 1.00
R6092:Uty UTSW Y 1174836 missense probably benign 0.08
R6759:Uty UTSW Y 1174735 missense probably damaging 0.98
R6761:Uty UTSW Y 1186790 missense probably damaging 1.00
R6949:Uty UTSW Y 1240000 intron probably null
R7177:Uty UTSW Y 1099691 missense probably benign 0.33
R7469:Uty UTSW Y 1131072 missense possibly damaging 0.71
R7582:Uty UTSW Y 1170914 missense probably damaging 1.00
R7686:Uty UTSW Y 1158075 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCATCTGTAAACAAAATTTTCTTCCA -3'
(R):5'- GGAAGGAATACATTAGGGTGATAATTT -3'

Sequencing Primer
(F):5'- CTTCCAGAGACTAGATAATAAACAT -3'
(R):5'- GAATGCTTACTAATTCATTCCAT -3'
Posted On2019-06-26