Mutagenetix > Incidental Mutation

Incidental Mutation 'R7252:Pik3c2b'

563962

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R7252 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 133094734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1138 (R1138H)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably benign
Transcript: ENSMUST00000077730
AA Change: R1138H

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: R1138H

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Meta Mutation Damage Score

0.4555

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	G	T	X: 78,370,705	M345I	probably benign	Het
A730017C20Rik	A	G	18: 59,066,908		probably null	Het
Abcc2	T	A	19: 43,827,949	I1226N	probably damaging	Het
Adarb2	A	G	13: 8,570,180	E234G	probably benign	Het
Ankrd52	T	C	10: 128,381,996	S282P	probably damaging	Het
Arhgef12	A	T	9: 43,015,909	S306R	probably benign	Het
Baiap2	G	T	11: 120,003,039	A514S	probably benign	Het
BC030500	T	A	8: 58,911,804		probably null	Het
C1qtnf12	T	A	4: 155,962,615	W13R	unknown	Het
C87977	T	C	4: 144,212,940	D9G	possibly damaging	Het
Ccdc158	A	G	5: 92,650,788	V351A	probably benign	Het
Cct8	T	C	16: 87,484,919	E485G	probably benign	Het
Cep85	T	C	4: 134,148,031	D542G	probably benign	Het
Clhc1	T	A	11: 29,563,937	S340R	probably benign	Het
Cnot4	A	T	6: 35,069,427	D168E	probably damaging	Het
Cntn5	G	A	9: 9,831,635	T375I	probably benign	Het
Ctc1	T	A	11: 69,026,174	I298N	probably damaging	Het
Dchs2	T	A	3: 83,325,303	N2198K	probably benign	Het
Ddx6	G	A	9: 44,623,753		probably null	Het
Defb11	A	G	8: 21,905,457	I68T	probably benign	Het
Dip2a	C	T	10: 76,273,202	V1212I	not run	Het
Dopey1	T	A	9: 86,500,821	I269N	probably damaging	Het
Efna3	C	T	3: 89,316,664	G73S	possibly damaging	Het
Fam98b	C	G	2: 117,263,892	R228G	probably damaging	Het
Fancd2	A	T	6: 113,556,285	N521I	probably damaging	Het
Farsa	A	G	8: 84,861,328	D134G	probably damaging	Het
Fat2	A	T	11: 55,311,262	F329I	probably damaging	Het
Gm14399	A	T	2: 175,133,198	I43K	probably damaging	Het
Gpr15	A	G	16: 58,718,397	S110P	probably damaging	Het
Gpr157	T	C	4: 150,098,874	V167A	probably benign	Het
Hacd4	A	G	4: 88,426,763	I134T	possibly damaging	Het
Hpgd	T	A	8: 56,298,426	N96K	probably damaging	Het
Insm2	A	T	12: 55,600,520	T350S	probably benign	Het
Iqch	C	T	9: 63,512,236		probably null	Het
Kmt2d	A	G	15: 98,844,266	S4338P	unknown	Het
Krtap9-3	A	G	11: 99,597,970	S29P	probably benign	Het
Kyat3	T	A	3: 142,720,458	S87T	probably benign	Het
Mrpl46	T	C	7: 78,780,588	T145A	probably benign	Het
Neb	A	G	2: 52,324,961		probably null	Het
Olfr1232	T	A	2: 89,326,285		probably benign	Het
Olfr170	A	T	16: 19,606,499	H55Q	probably damaging	Het
Olfr461	A	G	6: 40,544,769	I70T	probably benign	Het
Olfr829	A	G	9: 18,857,252	Y200C	probably damaging	Het
Olfr986	C	T	9: 40,187,361	T82I	probably benign	Het
Otogl	T	C	10: 107,821,943	D1042G	probably benign	Het
Paxip1	C	T	5: 27,760,086	V659I	probably damaging	Het
Pfkl	A	G	10: 77,993,429	W382R	probably damaging	Het
Pfn1	A	G	11: 70,654,471	W4R	probably damaging	Het
Pkd1l3	A	G	8: 109,660,698	D1758G	probably benign	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Prdm12	A	G	2: 31,642,374	N132S	possibly damaging	Het
Prokr2	T	A	2: 132,381,440	M61L	probably benign	Het
Ralgapa2	T	C	2: 146,342,751		probably null	Het
Ralgps1	A	T	2: 33,168,188	D301E	probably benign	Het
Rcbtb2	T	C	14: 73,166,780	Y231H	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Relb	C	A	7: 19,612,613	E345*	probably null	Het
Rhbdl3	A	C	11: 80,337,585	M294L	possibly damaging	Het
Rpl24	G	A	16: 55,970,116	A112T	possibly damaging	Het
Rsbn1l	C	T	5: 20,908,198	R442Q	probably damaging	Het
Rxfp3	A	T	15: 11,035,939	I449N	probably benign	Het
Sema4c	A	C	1: 36,550,015	C677G	probably damaging	Het
Sf3b3	A	C	8: 110,839,930	I256S	probably damaging	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Slc39a6	G	T	18: 24,601,385	N82K	possibly damaging	Het
Slc3a2	T	C	19: 8,723,157		probably benign	Het
Stard13	T	C	5: 151,063,169	Q292R	probably benign	Het
Tgm6	A	G	2: 130,144,964	R451G	probably damaging	Het
Tspo	G	T	15: 83,572,265	G83V	probably damaging	Het
Ubxn10	T	C	4: 138,720,876	Q163R	probably benign	Het
Ushbp1	A	G	8: 71,394,602	S129P	probably benign	Het
Vmn2r23	T	A	6: 123,741,581	V631D	probably damaging	Het
Vmn2r24	T	C	6: 123,787,232	I356T	possibly damaging	Het
Vmn2r84	C	T	10: 130,386,410	C647Y	probably damaging	Het
Vps13a	T	C	19: 16,661,064	E2356G	probably benign	Het
Wdr64	A	G	1: 175,775,674	T614A	probably benign	Het
Zdhhc16	G	T	19: 41,941,551	W271L	probably damaging	Het
Zer1	A	C	2: 30,101,892	S652A	probably damaging	Het
Zfp287	A	G	11: 62,724,829	V224A	probably damaging	Het
Zfp438	A	T	18: 5,214,874	L28*	probably null	Het
Zfp830	G	A	11: 82,764,708	A113T	probably benign	Het
Zfp865	G	T	7: 5,034,417		probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGCATGGTTTTCTGCCC -3'
(R):5'- TGGCTCATCTGTGCACATGC -3'

Sequencing Primer
(F):5'- GCCCATCGTCCCTCATGG -3'
(R):5'- GCACATGCAGGTCTGGTG -3'

Posted On

2019-06-26