Incidental Mutation 'R7252:Zer1'
ID563965
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7252 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30101892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 652 (S652A)
Ref Sequence ENSEMBL: ENSMUSP00000046441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect probably damaging
Transcript: ENSMUST00000044751
AA Change: S652A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: S652A

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113677
AA Change: S639A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: S639A

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
A730017C20Rik A G 18: 59,066,908 probably null Het
Abcc2 T A 19: 43,827,949 I1226N probably damaging Het
Adarb2 A G 13: 8,570,180 E234G probably benign Het
Ankrd52 T C 10: 128,381,996 S282P probably damaging Het
Arhgef12 A T 9: 43,015,909 S306R probably benign Het
Baiap2 G T 11: 120,003,039 A514S probably benign Het
BC030500 T A 8: 58,911,804 probably null Het
C1qtnf12 T A 4: 155,962,615 W13R unknown Het
C87977 T C 4: 144,212,940 D9G possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Cct8 T C 16: 87,484,919 E485G probably benign Het
Cep85 T C 4: 134,148,031 D542G probably benign Het
Clhc1 T A 11: 29,563,937 S340R probably benign Het
Cnot4 A T 6: 35,069,427 D168E probably damaging Het
Cntn5 G A 9: 9,831,635 T375I probably benign Het
Ctc1 T A 11: 69,026,174 I298N probably damaging Het
Dchs2 T A 3: 83,325,303 N2198K probably benign Het
Ddx6 G A 9: 44,623,753 probably null Het
Defb11 A G 8: 21,905,457 I68T probably benign Het
Dip2a C T 10: 76,273,202 V1212I not run Het
Dopey1 T A 9: 86,500,821 I269N probably damaging Het
Efna3 C T 3: 89,316,664 G73S possibly damaging Het
Fam98b C G 2: 117,263,892 R228G probably damaging Het
Fancd2 A T 6: 113,556,285 N521I probably damaging Het
Farsa A G 8: 84,861,328 D134G probably damaging Het
Fat2 A T 11: 55,311,262 F329I probably damaging Het
Gm14399 A T 2: 175,133,198 I43K probably damaging Het
Gpr15 A G 16: 58,718,397 S110P probably damaging Het
Gpr157 T C 4: 150,098,874 V167A probably benign Het
Hacd4 A G 4: 88,426,763 I134T possibly damaging Het
Hpgd T A 8: 56,298,426 N96K probably damaging Het
Insm2 A T 12: 55,600,520 T350S probably benign Het
Iqch C T 9: 63,512,236 probably null Het
Kmt2d A G 15: 98,844,266 S4338P unknown Het
Krtap9-3 A G 11: 99,597,970 S29P probably benign Het
Kyat3 T A 3: 142,720,458 S87T probably benign Het
Mrpl46 T C 7: 78,780,588 T145A probably benign Het
Neb A G 2: 52,324,961 probably null Het
Olfr1232 T A 2: 89,326,285 probably benign Het
Olfr170 A T 16: 19,606,499 H55Q probably damaging Het
Olfr461 A G 6: 40,544,769 I70T probably benign Het
Olfr829 A G 9: 18,857,252 Y200C probably damaging Het
Olfr986 C T 9: 40,187,361 T82I probably benign Het
Otogl T C 10: 107,821,943 D1042G probably benign Het
Paxip1 C T 5: 27,760,086 V659I probably damaging Het
Pfkl A G 10: 77,993,429 W382R probably damaging Het
Pfn1 A G 11: 70,654,471 W4R probably damaging Het
Pik3c2b G A 1: 133,094,734 R1138H probably benign Het
Pkd1l3 A G 8: 109,660,698 D1758G probably benign Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prdm12 A G 2: 31,642,374 N132S possibly damaging Het
Prokr2 T A 2: 132,381,440 M61L probably benign Het
Ralgapa2 T C 2: 146,342,751 probably null Het
Ralgps1 A T 2: 33,168,188 D301E probably benign Het
Rcbtb2 T C 14: 73,166,780 Y231H probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Relb C A 7: 19,612,613 E345* probably null Het
Rhbdl3 A C 11: 80,337,585 M294L possibly damaging Het
Rpl24 G A 16: 55,970,116 A112T possibly damaging Het
Rsbn1l C T 5: 20,908,198 R442Q probably damaging Het
Rxfp3 A T 15: 11,035,939 I449N probably benign Het
Sema4c A C 1: 36,550,015 C677G probably damaging Het
Sf3b3 A C 8: 110,839,930 I256S probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slc39a6 G T 18: 24,601,385 N82K possibly damaging Het
Slc3a2 T C 19: 8,723,157 probably benign Het
Stard13 T C 5: 151,063,169 Q292R probably benign Het
Tgm6 A G 2: 130,144,964 R451G probably damaging Het
Tspo G T 15: 83,572,265 G83V probably damaging Het
Ubxn10 T C 4: 138,720,876 Q163R probably benign Het
Ushbp1 A G 8: 71,394,602 S129P probably benign Het
Vmn2r23 T A 6: 123,741,581 V631D probably damaging Het
Vmn2r24 T C 6: 123,787,232 I356T possibly damaging Het
Vmn2r84 C T 10: 130,386,410 C647Y probably damaging Het
Vps13a T C 19: 16,661,064 E2356G probably benign Het
Wdr64 A G 1: 175,775,674 T614A probably benign Het
Zdhhc16 G T 19: 41,941,551 W271L probably damaging Het
Zfp287 A G 11: 62,724,829 V224A probably damaging Het
Zfp438 A T 18: 5,214,874 L28* probably null Het
Zfp830 G A 11: 82,764,708 A113T probably benign Het
Zfp865 G T 7: 5,034,417 probably benign Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGAGACAAGCAGCTTCTG -3'
(R):5'- GCCAGCCTGACTCAAAAGTAG -3'

Sequencing Primer
(F):5'- GAGACAAGCAGCTTCTGATTCTC -3'
(R):5'- CCAAGTGATTTTCAGCTGAGCAG -3'
Posted On2019-06-26