Incidental Mutation 'R7252:Olfr461'
ID563991
Institutional Source Beutler Lab
Gene Symbol Olfr461
Ensembl Gene ENSMUSG00000068259
Gene Nameolfactory receptor 461
SynonymsMOR120-3, GA_x6K02T2P3E9-6973252-6974193
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7252 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location40542171-40555050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40544769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 70 (I70T)
Ref Sequence ENSEMBL: ENSMUSP00000150632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089490] [ENSMUST00000215009]
Predicted Effect probably benign
Transcript: ENSMUST00000089490
AA Change: I70T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086917
Gene: ENSMUSG00000068259
AA Change: I70T

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 2e-41 PFAM
Pfam:7tm_1 40 289 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215009
AA Change: I70T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
A730017C20Rik A G 18: 59,066,908 probably null Het
Abcc2 T A 19: 43,827,949 I1226N probably damaging Het
Adarb2 A G 13: 8,570,180 E234G probably benign Het
Ankrd52 T C 10: 128,381,996 S282P probably damaging Het
Arhgef12 A T 9: 43,015,909 S306R probably benign Het
Baiap2 G T 11: 120,003,039 A514S probably benign Het
BC030500 T A 8: 58,911,804 probably null Het
C1qtnf12 T A 4: 155,962,615 W13R unknown Het
C87977 T C 4: 144,212,940 D9G possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Cct8 T C 16: 87,484,919 E485G probably benign Het
Cep85 T C 4: 134,148,031 D542G probably benign Het
Clhc1 T A 11: 29,563,937 S340R probably benign Het
Cnot4 A T 6: 35,069,427 D168E probably damaging Het
Cntn5 G A 9: 9,831,635 T375I probably benign Het
Ctc1 T A 11: 69,026,174 I298N probably damaging Het
Dchs2 T A 3: 83,325,303 N2198K probably benign Het
Ddx6 G A 9: 44,623,753 probably null Het
Defb11 A G 8: 21,905,457 I68T probably benign Het
Dip2a C T 10: 76,273,202 V1212I not run Het
Dopey1 T A 9: 86,500,821 I269N probably damaging Het
Efna3 C T 3: 89,316,664 G73S possibly damaging Het
Fam98b C G 2: 117,263,892 R228G probably damaging Het
Fancd2 A T 6: 113,556,285 N521I probably damaging Het
Farsa A G 8: 84,861,328 D134G probably damaging Het
Fat2 A T 11: 55,311,262 F329I probably damaging Het
Gm14399 A T 2: 175,133,198 I43K probably damaging Het
Gpr15 A G 16: 58,718,397 S110P probably damaging Het
Gpr157 T C 4: 150,098,874 V167A probably benign Het
Hacd4 A G 4: 88,426,763 I134T possibly damaging Het
Hpgd T A 8: 56,298,426 N96K probably damaging Het
Insm2 A T 12: 55,600,520 T350S probably benign Het
Iqch C T 9: 63,512,236 probably null Het
Kmt2d A G 15: 98,844,266 S4338P unknown Het
Krtap9-3 A G 11: 99,597,970 S29P probably benign Het
Kyat3 T A 3: 142,720,458 S87T probably benign Het
Mrpl46 T C 7: 78,780,588 T145A probably benign Het
Neb A G 2: 52,324,961 probably null Het
Olfr1232 T A 2: 89,326,285 probably benign Het
Olfr170 A T 16: 19,606,499 H55Q probably damaging Het
Olfr829 A G 9: 18,857,252 Y200C probably damaging Het
Olfr986 C T 9: 40,187,361 T82I probably benign Het
Otogl T C 10: 107,821,943 D1042G probably benign Het
Paxip1 C T 5: 27,760,086 V659I probably damaging Het
Pfkl A G 10: 77,993,429 W382R probably damaging Het
Pfn1 A G 11: 70,654,471 W4R probably damaging Het
Pik3c2b G A 1: 133,094,734 R1138H probably benign Het
Pkd1l3 A G 8: 109,660,698 D1758G probably benign Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prdm12 A G 2: 31,642,374 N132S possibly damaging Het
Prokr2 T A 2: 132,381,440 M61L probably benign Het
Ralgapa2 T C 2: 146,342,751 probably null Het
Ralgps1 A T 2: 33,168,188 D301E probably benign Het
Rcbtb2 T C 14: 73,166,780 Y231H probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Relb C A 7: 19,612,613 E345* probably null Het
Rhbdl3 A C 11: 80,337,585 M294L possibly damaging Het
Rpl24 G A 16: 55,970,116 A112T possibly damaging Het
Rsbn1l C T 5: 20,908,198 R442Q probably damaging Het
Rxfp3 A T 15: 11,035,939 I449N probably benign Het
Sema4c A C 1: 36,550,015 C677G probably damaging Het
Sf3b3 A C 8: 110,839,930 I256S probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slc39a6 G T 18: 24,601,385 N82K possibly damaging Het
Slc3a2 T C 19: 8,723,157 probably benign Het
Stard13 T C 5: 151,063,169 Q292R probably benign Het
Tgm6 A G 2: 130,144,964 R451G probably damaging Het
Tspo G T 15: 83,572,265 G83V probably damaging Het
Ubxn10 T C 4: 138,720,876 Q163R probably benign Het
Ushbp1 A G 8: 71,394,602 S129P probably benign Het
Vmn2r23 T A 6: 123,741,581 V631D probably damaging Het
Vmn2r24 T C 6: 123,787,232 I356T possibly damaging Het
Vmn2r84 C T 10: 130,386,410 C647Y probably damaging Het
Vps13a T C 19: 16,661,064 E2356G probably benign Het
Wdr64 A G 1: 175,775,674 T614A probably benign Het
Zdhhc16 G T 19: 41,941,551 W271L probably damaging Het
Zer1 A C 2: 30,101,892 S652A probably damaging Het
Zfp287 A G 11: 62,724,829 V224A probably damaging Het
Zfp438 A T 18: 5,214,874 L28* probably null Het
Zfp830 G A 11: 82,764,708 A113T probably benign Het
Zfp865 G T 7: 5,034,417 probably benign Het
Other mutations in Olfr461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Olfr461 APN 6 40544046 missense probably damaging 0.96
IGL03245:Olfr461 APN 6 40544142 missense probably damaging 0.98
R0325:Olfr461 UTSW 6 40544123 missense possibly damaging 0.95
R0835:Olfr461 UTSW 6 40544338 missense probably benign 0.01
R1594:Olfr461 UTSW 6 40544347 missense probably benign 0.00
R2437:Olfr461 UTSW 6 40544922 missense probably benign 0.37
R6360:Olfr461 UTSW 6 40544713 missense possibly damaging 0.83
R6970:Olfr461 UTSW 6 40544656 missense probably benign 0.31
R7326:Olfr461 UTSW 6 40544895 missense probably damaging 0.97
RF003:Olfr461 UTSW 6 40544362 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCAAAGGGTTGCAGACAGC -3'
(R):5'- TGCTCAGAAACAAATGTTGGG -3'

Sequencing Primer
(F):5'- GGTTGCAGACAGCCACATAC -3'
(R):5'- GTTGGGAAACTACTCTAGTGCCAC -3'
Posted On2019-06-26