Incidental Mutation 'R0580:Olfr1393'
ID 56401
Institutional Source Beutler Lab
Gene Symbol Olfr1393
Ensembl Gene ENSMUSG00000059864
Gene Name olfactory receptor 1393
Synonyms MOR256-67_i, GA_x6K02T2QP88-6154577-6153642, MOR256-24
MMRRC Submission 038770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R0580 (G1)
Quality Score 151
Status Validated
Chromosome 11
Chromosomal Location 49278304-49282769 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49280622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 158 (I158N)
Ref Sequence ENSEMBL: ENSMUSP00000149358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078932] [ENSMUST00000213323] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
AlphaFold Q8VFA7
Predicted Effect probably damaging
Transcript: ENSMUST00000078932
AA Change: I158N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077962
Gene: ENSMUSG00000059864
AA Change: I158N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 230 3e-6 PFAM
Pfam:7tm_1 41 289 5.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213323
AA Change: I158N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213684
Predicted Effect probably benign
Transcript: ENSMUST00000214170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214516
Predicted Effect probably benign
Transcript: ENSMUST00000214598
Predicted Effect probably benign
Transcript: ENSMUST00000215861
Predicted Effect probably benign
Transcript: ENSMUST00000217275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217626
Meta Mutation Damage Score 0.4671 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,305,956 probably null Het
Adgrg5 T C 8: 94,937,344 probably null Het
Akap12 A T 10: 4,354,741 D517V possibly damaging Het
Arhgap23 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 97,446,536 probably null Het
Bpi A T 2: 158,258,295 M1L probably damaging Het
Carm1 C T 9: 21,583,584 P339S probably damaging Het
Chchd3 A C 6: 32,893,390 probably null Het
Chd9 T C 8: 90,994,563 V520A possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Col10a1 A G 10: 34,394,952 R307G probably benign Het
Cpeb3 T C 19: 37,174,035 T314A probably benign Het
Csmd1 A T 8: 15,910,528 Y3296N probably damaging Het
Dtx2 A T 5: 136,032,326 T521S probably damaging Het
Ext2 A T 2: 93,795,725 V330E probably benign Het
Extl3 A G 14: 65,075,729 L668P probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gm8298 T A 3: 59,877,049 D314E probably damaging Het
Grm8 A G 6: 27,761,371 probably benign Het
Herc2 T A 7: 56,138,791 V1763D probably damaging Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqce A G 5: 140,665,401 F768L possibly damaging Het
Kntc1 G A 5: 123,803,669 V1809I probably benign Het
Lyzl1 A C 18: 4,181,134 T58P probably damaging Het
Mlxipl A G 5: 135,123,975 T287A probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Net1 A G 13: 3,886,612 Y264H probably damaging Het
Nnmt T C 9: 48,592,300 D142G probably damaging Het
Nod2 T A 8: 88,664,406 I432N probably damaging Het
Olfr711 A G 7: 106,972,240 Y35H probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pign A C 1: 105,591,694 I501S probably benign Het
Scgb2b19 A T 7: 33,278,570 S101T probably benign Het
Slc7a5 A T 8: 121,885,116 M391K probably benign Het
Sptan1 A G 2: 30,007,575 R1217G probably damaging Het
Srgap2 A G 1: 131,349,501 V336A possibly damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Syt10 A T 15: 89,827,176 D51E probably benign Het
Vmn2r96 T C 17: 18,582,638 V270A probably damaging Het
Other mutations in Olfr1393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Olfr1393 APN 11 49280487 missense possibly damaging 0.94
IGL02291:Olfr1393 APN 11 49280985 missense probably damaging 1.00
IGL03127:Olfr1393 APN 11 49280772 missense possibly damaging 0.88
R1985:Olfr1393 UTSW 11 49280283 missense probably damaging 1.00
R4812:Olfr1393 UTSW 11 49280457 missense possibly damaging 0.94
R5190:Olfr1393 UTSW 11 49280382 missense probably damaging 0.99
R6694:Olfr1393 UTSW 11 49280552 missense probably benign 0.01
R6911:Olfr1393 UTSW 11 49280807 missense probably benign 0.22
R7012:Olfr1393 UTSW 11 49280996 missense probably benign 0.07
R7159:Olfr1393 UTSW 11 49280358 missense probably damaging 1.00
R7541:Olfr1393 UTSW 11 49280333 missense probably damaging 1.00
R7759:Olfr1393 UTSW 11 49280636 missense probably benign 0.00
R8767:Olfr1393 UTSW 11 49280400 missense possibly damaging 0.87
R9069:Olfr1393 UTSW 11 49280420 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTCCTCATCAACCTGCATGGAC -3'
(R):5'- AGCCACTGACTTGACCTTCAGCAC -3'

Sequencing Primer
(F):5'- CAGGACCATCAGCTATGGAG -3'
(R):5'- ACCGCCCTAGCAATCTGTG -3'
Posted On 2013-07-11