Incidental Mutation 'R0580:Arhgap23'
ID56402
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission 038770-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0580 (G1)
Quality Score107
Status Validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGAGGAGGAGGAGGAGG to AGAGGAGGAGGAGG at 97446536 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799]
Predicted Effect probably benign
Transcript: ENSMUST00000107601
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121799
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152933
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,305,956 probably null Het
Adgrg5 T C 8: 94,937,344 probably null Het
Akap12 A T 10: 4,354,741 D517V possibly damaging Het
Bpi A T 2: 158,258,295 M1L probably damaging Het
Carm1 C T 9: 21,583,584 P339S probably damaging Het
Chchd3 A C 6: 32,893,390 probably null Het
Chd9 T C 8: 90,994,563 V520A possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Col10a1 A G 10: 34,394,952 R307G probably benign Het
Cpeb3 T C 19: 37,174,035 T314A probably benign Het
Csmd1 A T 8: 15,910,528 Y3296N probably damaging Het
Dtx2 A T 5: 136,032,326 T521S probably damaging Het
Ext2 A T 2: 93,795,725 V330E probably benign Het
Extl3 A G 14: 65,075,729 L668P probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gm8298 T A 3: 59,877,049 D314E probably damaging Het
Grm8 A G 6: 27,761,371 probably benign Het
Herc2 T A 7: 56,138,791 V1763D probably damaging Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqce A G 5: 140,665,401 F768L possibly damaging Het
Kntc1 G A 5: 123,803,669 V1809I probably benign Het
Lyzl1 A C 18: 4,181,134 T58P probably damaging Het
Mlxipl A G 5: 135,123,975 T287A probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Net1 A G 13: 3,886,612 Y264H probably damaging Het
Nnmt T C 9: 48,592,300 D142G probably damaging Het
Nod2 T A 8: 88,664,406 I432N probably damaging Het
Olfr1393 T A 11: 49,280,622 I158N probably damaging Het
Olfr711 A G 7: 106,972,240 Y35H probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pign A C 1: 105,591,694 I501S probably benign Het
Scgb2b19 A T 7: 33,278,570 S101T probably benign Het
Slc7a5 A T 8: 121,885,116 M391K probably benign Het
Sptan1 A G 2: 30,007,575 R1217G probably damaging Het
Srgap2 A G 1: 131,349,501 V336A possibly damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Syt10 A T 15: 89,827,176 D51E probably benign Het
Vmn2r96 T C 17: 18,582,638 V270A probably damaging Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7209:Arhgap23 UTSW 11 97492447 splice site probably null
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
R8229:Arhgap23 UTSW 11 97453906 missense probably benign 0.36
R8412:Arhgap23 UTSW 11 97466028 missense probably benign 0.02
R8460:Arhgap23 UTSW 11 97452371 missense probably damaging 1.00
R8492:Arhgap23 UTSW 11 97475021 missense probably damaging 1.00
R8525:Arhgap23 UTSW 11 97490084 missense probably damaging 1.00
R8692:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R8708:Arhgap23 UTSW 11 97452412 missense probably benign 0.06
R8749:Arhgap23 UTSW 11 97500815 missense probably damaging 0.99
R8882:Arhgap23 UTSW 11 97465123 missense probably benign 0.00
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATCCTGACTGGGACACCTCTGAC -3'
(R):5'- TCAGTATCAGATGGCTGTGGGAGC -3'

Sequencing Primer
(F):5'- GGACACCTCTGACAGCTCTC -3'
(R):5'- CTGTGGGAGCGACAGGC -3'
Posted On2013-07-11