Incidental Mutation 'R7252:Kmt2d'
ID 564031
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll4, Mll2, C430014K11Rik
MMRRC Submission 045385-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7252 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98729550-98769085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98742147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 4338 (S4338P)
Ref Sequence ENSEMBL: ENSMUSP00000023741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: S4338P
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: S4338P

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: S4338P
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: S4338P

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 77,414,311 (GRCm39) M345I probably benign Het
Abcc2 T A 19: 43,816,388 (GRCm39) I1226N probably damaging Het
Adarb2 A G 13: 8,620,216 (GRCm39) E234G probably benign Het
Ankrd52 T C 10: 128,217,865 (GRCm39) S282P probably damaging Het
Arhgef12 A T 9: 42,927,205 (GRCm39) S306R probably benign Het
Baiap2 G T 11: 119,893,865 (GRCm39) A514S probably benign Het
BC030500 T A 8: 59,364,838 (GRCm39) probably null Het
C1qtnf12 T A 4: 156,047,072 (GRCm39) W13R unknown Het
Ccdc158 A G 5: 92,798,647 (GRCm39) V351A probably benign Het
Cct8 T C 16: 87,281,807 (GRCm39) E485G probably benign Het
Cep85 T C 4: 133,875,342 (GRCm39) D542G probably benign Het
Clhc1 T A 11: 29,513,937 (GRCm39) S340R probably benign Het
Cnot4 A T 6: 35,046,362 (GRCm39) D168E probably damaging Het
Cntn5 G A 9: 9,831,640 (GRCm39) T375I probably benign Het
Ctc1 T A 11: 68,917,000 (GRCm39) I298N probably damaging Het
Dchs2 T A 3: 83,232,610 (GRCm39) N2198K probably benign Het
Ddx6 G A 9: 44,535,050 (GRCm39) probably null Het
Defb11 A G 8: 22,395,473 (GRCm39) I68T probably benign Het
Dip2a C T 10: 76,109,036 (GRCm39) V1212I not run Het
Dop1a T A 9: 86,382,874 (GRCm39) I269N probably damaging Het
Efna3 C T 3: 89,223,971 (GRCm39) G73S possibly damaging Het
Fam98b C G 2: 117,094,373 (GRCm39) R228G probably damaging Het
Fancd2 A T 6: 113,533,246 (GRCm39) N521I probably damaging Het
Farsa A G 8: 85,587,957 (GRCm39) D134G probably damaging Het
Fat2 A T 11: 55,202,088 (GRCm39) F329I probably damaging Het
Gm14399 A T 2: 174,974,991 (GRCm39) I43K probably damaging Het
Gpr15 A G 16: 58,538,760 (GRCm39) S110P probably damaging Het
Gpr157 T C 4: 150,183,331 (GRCm39) V167A probably benign Het
Hacd4 A G 4: 88,345,000 (GRCm39) I134T possibly damaging Het
Hpgd T A 8: 56,751,461 (GRCm39) N96K probably damaging Het
Insm2 A T 12: 55,647,305 (GRCm39) T350S probably benign Het
Iqch C T 9: 63,419,518 (GRCm39) probably null Het
Krtap9-3 A G 11: 99,488,796 (GRCm39) S29P probably benign Het
Kyat3 T A 3: 142,426,219 (GRCm39) S87T probably benign Het
Minar2 A G 18: 59,199,980 (GRCm39) probably null Het
Mrpl46 T C 7: 78,430,336 (GRCm39) T145A probably benign Het
Neb A G 2: 52,214,973 (GRCm39) probably null Het
Or2aj5 A T 16: 19,425,249 (GRCm39) H55Q probably damaging Het
Or4c124 T A 2: 89,156,629 (GRCm39) probably benign Het
Or6x1 C T 9: 40,098,657 (GRCm39) T82I probably benign Het
Or7g17 A G 9: 18,768,548 (GRCm39) Y200C probably damaging Het
Or9a7 A G 6: 40,521,703 (GRCm39) I70T probably benign Het
Otogl T C 10: 107,657,804 (GRCm39) D1042G probably benign Het
Paxip1 C T 5: 27,965,084 (GRCm39) V659I probably damaging Het
Pfkl A G 10: 77,829,263 (GRCm39) W382R probably damaging Het
Pfn1 A G 11: 70,545,297 (GRCm39) W4R probably damaging Het
Pik3c2b G A 1: 133,022,472 (GRCm39) R1138H probably benign Het
Pkd1l3 A G 8: 110,387,330 (GRCm39) D1758G probably benign Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Pramel29 T C 4: 143,939,510 (GRCm39) D9G possibly damaging Het
Prdm12 A G 2: 31,532,386 (GRCm39) N132S possibly damaging Het
Prokr2 T A 2: 132,223,360 (GRCm39) M61L probably benign Het
Ralgapa2 T C 2: 146,184,671 (GRCm39) probably null Het
Ralgps1 A T 2: 33,058,200 (GRCm39) D301E probably benign Het
Rcbtb2 T C 14: 73,404,220 (GRCm39) Y231H probably damaging Het
Rcc2 G A 4: 140,429,586 (GRCm39) C40Y probably benign Het
Relb C A 7: 19,346,538 (GRCm39) E345* probably null Het
Rhbdl3 A C 11: 80,228,411 (GRCm39) M294L possibly damaging Het
Rpl24 G A 16: 55,790,479 (GRCm39) A112T possibly damaging Het
Rsbn1l C T 5: 21,113,196 (GRCm39) R442Q probably damaging Het
Rxfp3 A T 15: 11,036,025 (GRCm39) I449N probably benign Het
Sema4c A C 1: 36,589,096 (GRCm39) C677G probably damaging Het
Sf3b3 A C 8: 111,566,562 (GRCm39) I256S probably damaging Het
Shank1 C T 7: 43,976,585 (GRCm39) A561V unknown Het
Slc39a6 G T 18: 24,734,442 (GRCm39) N82K possibly damaging Het
Slc3a2 T C 19: 8,700,521 (GRCm39) probably benign Het
Stard13 T C 5: 150,986,634 (GRCm39) Q292R probably benign Het
Tgm6 A G 2: 129,986,884 (GRCm39) R451G probably damaging Het
Tspo G T 15: 83,456,466 (GRCm39) G83V probably damaging Het
Ubxn10 T C 4: 138,448,187 (GRCm39) Q163R probably benign Het
Ushbp1 A G 8: 71,847,246 (GRCm39) S129P probably benign Het
Vmn2r23 T A 6: 123,718,540 (GRCm39) V631D probably damaging Het
Vmn2r24 T C 6: 123,764,191 (GRCm39) I356T possibly damaging Het
Vmn2r84 C T 10: 130,222,279 (GRCm39) C647Y probably damaging Het
Vps13a T C 19: 16,638,428 (GRCm39) E2356G probably benign Het
Wdr64 A G 1: 175,603,240 (GRCm39) T614A probably benign Het
Zdhhc16 G T 19: 41,929,990 (GRCm39) W271L probably damaging Het
Zer1 A C 2: 29,991,904 (GRCm39) S652A probably damaging Het
Zfp287 A G 11: 62,615,655 (GRCm39) V224A probably damaging Het
Zfp438 A T 18: 5,214,874 (GRCm39) L28* probably null Het
Zfp830 G A 11: 82,655,534 (GRCm39) A113T probably benign Het
Zfp865 G T 7: 5,037,416 (GRCm39) probably benign Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98,760,214 (GRCm39) missense unknown
IGL00927:Kmt2d APN 15 98,742,890 (GRCm39) unclassified probably benign
IGL01123:Kmt2d APN 15 98,735,029 (GRCm39) missense unknown
IGL01288:Kmt2d APN 15 98,762,925 (GRCm39) missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98,758,538 (GRCm39) unclassified probably benign
IGL01575:Kmt2d APN 15 98,744,736 (GRCm39) utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98,754,250 (GRCm39) unclassified probably benign
IGL01750:Kmt2d APN 15 98,751,049 (GRCm39) unclassified probably benign
IGL02163:Kmt2d APN 15 98,733,109 (GRCm39) unclassified probably benign
IGL02209:Kmt2d APN 15 98,752,448 (GRCm39) unclassified probably benign
IGL02253:Kmt2d APN 15 98,756,056 (GRCm39) unclassified probably benign
IGL02271:Kmt2d APN 15 98,764,309 (GRCm39) missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98,763,373 (GRCm39) splice site probably benign
IGL02448:Kmt2d APN 15 98,741,991 (GRCm39) unclassified probably benign
IGL02472:Kmt2d APN 15 98,747,958 (GRCm39) missense probably benign 0.23
IGL02496:Kmt2d APN 15 98,755,439 (GRCm39) unclassified probably benign
IGL02527:Kmt2d APN 15 98,739,628 (GRCm39) unclassified probably benign
IGL02576:Kmt2d APN 15 98,762,001 (GRCm39) missense unknown
IGL02597:Kmt2d APN 15 98,761,712 (GRCm39) missense unknown
IGL02609:Kmt2d APN 15 98,749,674 (GRCm39) unclassified probably benign
IGL03085:Kmt2d APN 15 98,737,821 (GRCm39) unclassified probably benign
IGL03102:Kmt2d APN 15 98,753,424 (GRCm39) missense probably benign
IGL03123:Kmt2d APN 15 98,759,652 (GRCm39) missense unknown
G1citation:Kmt2d UTSW 15 98,747,340 (GRCm39) unclassified probably benign
R0091:Kmt2d UTSW 15 98,742,360 (GRCm39) unclassified probably benign
R0136:Kmt2d UTSW 15 98,752,159 (GRCm39) unclassified probably benign
R0243:Kmt2d UTSW 15 98,748,018 (GRCm39) unclassified probably benign
R0276:Kmt2d UTSW 15 98,748,192 (GRCm39) unclassified probably benign
R0477:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0478:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0586:Kmt2d UTSW 15 98,733,088 (GRCm39) unclassified probably benign
R0632:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0678:Kmt2d UTSW 15 98,748,294 (GRCm39) unclassified probably benign
R0780:Kmt2d UTSW 15 98,760,738 (GRCm39) missense unknown
R0891:Kmt2d UTSW 15 98,750,572 (GRCm39) unclassified probably benign
R1136:Kmt2d UTSW 15 98,755,646 (GRCm39) unclassified probably benign
R1417:Kmt2d UTSW 15 98,764,311 (GRCm39) missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98,742,819 (GRCm39) unclassified probably benign
R1510:Kmt2d UTSW 15 98,754,258 (GRCm39) unclassified probably benign
R1586:Kmt2d UTSW 15 98,762,934 (GRCm39) splice site probably benign
R1640:Kmt2d UTSW 15 98,742,938 (GRCm39) unclassified probably benign
R1714:Kmt2d UTSW 15 98,760,831 (GRCm39) missense unknown
R1725:Kmt2d UTSW 15 98,743,115 (GRCm39) unclassified probably benign
R1728:Kmt2d UTSW 15 98,763,013 (GRCm39) missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98,763,013 (GRCm39) missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98,743,115 (GRCm39) unclassified probably benign
R1744:Kmt2d UTSW 15 98,762,928 (GRCm39) missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98,762,259 (GRCm39) missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98,741,363 (GRCm39) unclassified probably benign
R1782:Kmt2d UTSW 15 98,755,429 (GRCm39) unclassified probably benign
R1789:Kmt2d UTSW 15 98,749,955 (GRCm39) unclassified probably benign
R1802:Kmt2d UTSW 15 98,760,866 (GRCm39) missense unknown
R1808:Kmt2d UTSW 15 98,764,567 (GRCm39) missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98,759,661 (GRCm39) missense unknown
R1831:Kmt2d UTSW 15 98,753,224 (GRCm39) missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98,753,472 (GRCm39) missense probably damaging 1.00
R1920:Kmt2d UTSW 15 98,753,471 (GRCm39) missense probably damaging 0.96
R1956:Kmt2d UTSW 15 98,757,471 (GRCm39) unclassified probably benign
R2100:Kmt2d UTSW 15 98,744,361 (GRCm39) unclassified probably benign
R2120:Kmt2d UTSW 15 98,737,410 (GRCm39) unclassified probably benign
R2188:Kmt2d UTSW 15 98,737,181 (GRCm39) unclassified probably benign
R2191:Kmt2d UTSW 15 98,758,930 (GRCm39) critical splice donor site probably null
R2234:Kmt2d UTSW 15 98,763,129 (GRCm39) missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98,760,147 (GRCm39) missense unknown
R2762:Kmt2d UTSW 15 98,749,936 (GRCm39) unclassified probably benign
R2895:Kmt2d UTSW 15 98,741,820 (GRCm39) unclassified probably benign
R3624:Kmt2d UTSW 15 98,740,783 (GRCm39) unclassified probably benign
R3791:Kmt2d UTSW 15 98,742,030 (GRCm39) unclassified probably benign
R3794:Kmt2d UTSW 15 98,735,240 (GRCm39) unclassified probably benign
R3871:Kmt2d UTSW 15 98,748,902 (GRCm39) unclassified probably benign
R3958:Kmt2d UTSW 15 98,753,430 (GRCm39) missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98,743,927 (GRCm39) unclassified probably benign
R4211:Kmt2d UTSW 15 98,738,070 (GRCm39) unclassified probably benign
R4212:Kmt2d UTSW 15 98,742,884 (GRCm39) unclassified probably benign
R4240:Kmt2d UTSW 15 98,742,452 (GRCm39) unclassified probably benign
R4246:Kmt2d UTSW 15 98,737,970 (GRCm39) unclassified probably benign
R4361:Kmt2d UTSW 15 98,761,551 (GRCm39) missense unknown
R4388:Kmt2d UTSW 15 98,751,507 (GRCm39) unclassified probably benign
R4602:Kmt2d UTSW 15 98,748,140 (GRCm39) unclassified probably benign
R4606:Kmt2d UTSW 15 98,737,597 (GRCm39) unclassified probably benign
R4658:Kmt2d UTSW 15 98,750,410 (GRCm39) unclassified probably benign
R4840:Kmt2d UTSW 15 98,759,775 (GRCm39) missense unknown
R4895:Kmt2d UTSW 15 98,742,368 (GRCm39) unclassified probably benign
R4906:Kmt2d UTSW 15 98,747,420 (GRCm39) unclassified probably benign
R4976:Kmt2d UTSW 15 98,745,075 (GRCm39) utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98,754,043 (GRCm39) missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98,745,075 (GRCm39) utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98,738,105 (GRCm39) unclassified probably benign
R5260:Kmt2d UTSW 15 98,740,741 (GRCm39) unclassified probably benign
R5274:Kmt2d UTSW 15 98,752,111 (GRCm39) unclassified probably benign
R5450:Kmt2d UTSW 15 98,752,967 (GRCm39) missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5462:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5463:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5465:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5467:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5481:Kmt2d UTSW 15 98,759,886 (GRCm39) missense unknown
R5509:Kmt2d UTSW 15 98,737,557 (GRCm39) unclassified probably benign
R5534:Kmt2d UTSW 15 98,735,238 (GRCm39) unclassified probably benign
R5536:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5537:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5538:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5546:Kmt2d UTSW 15 98,750,949 (GRCm39) unclassified probably benign
R5595:Kmt2d UTSW 15 98,747,905 (GRCm39) unclassified probably benign
R5645:Kmt2d UTSW 15 98,742,278 (GRCm39) unclassified probably benign
R5679:Kmt2d UTSW 15 98,752,153 (GRCm39) unclassified probably benign
R5710:Kmt2d UTSW 15 98,751,987 (GRCm39) unclassified probably benign
R5755:Kmt2d UTSW 15 98,761,527 (GRCm39) missense unknown
R5817:Kmt2d UTSW 15 98,760,244 (GRCm39) missense unknown
R5841:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5842:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5843:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5844:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5845:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R6122:Kmt2d UTSW 15 98,758,573 (GRCm39) unclassified probably benign
R6612:Kmt2d UTSW 15 98,743,739 (GRCm39) unclassified probably benign
R6718:Kmt2d UTSW 15 98,748,420 (GRCm39) unclassified probably benign
R6718:Kmt2d UTSW 15 98,747,467 (GRCm39) unclassified probably benign
R6822:Kmt2d UTSW 15 98,747,340 (GRCm39) unclassified probably benign
R6866:Kmt2d UTSW 15 98,755,274 (GRCm39) unclassified probably benign
R6950:Kmt2d UTSW 15 98,737,901 (GRCm39) unclassified probably benign
R7089:Kmt2d UTSW 15 98,748,153 (GRCm39) missense unknown
R7120:Kmt2d UTSW 15 98,758,946 (GRCm39) missense unknown
R7131:Kmt2d UTSW 15 98,747,497 (GRCm39) unclassified probably benign
R7177:Kmt2d UTSW 15 98,748,267 (GRCm39) missense unknown
R7194:Kmt2d UTSW 15 98,741,714 (GRCm39) missense unknown
R7282:Kmt2d UTSW 15 98,751,985 (GRCm39) missense unknown
R7307:Kmt2d UTSW 15 98,747,299 (GRCm39) missense unknown
R7313:Kmt2d UTSW 15 98,754,504 (GRCm39) missense unknown
R7394:Kmt2d UTSW 15 98,754,265 (GRCm39) missense unknown
R7404:Kmt2d UTSW 15 98,743,376 (GRCm39) missense unknown
R7409:Kmt2d UTSW 15 98,753,235 (GRCm39) missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98,737,737 (GRCm39) missense unknown
R7534:Kmt2d UTSW 15 98,749,899 (GRCm39) missense unknown
R7575:Kmt2d UTSW 15 98,747,492 (GRCm39) unclassified probably benign
R7650:Kmt2d UTSW 15 98,748,751 (GRCm39) missense unknown
R7687:Kmt2d UTSW 15 98,760,001 (GRCm39) missense unknown
R7699:Kmt2d UTSW 15 98,741,600 (GRCm39) missense unknown
R7700:Kmt2d UTSW 15 98,741,600 (GRCm39) missense unknown
R7765:Kmt2d UTSW 15 98,750,215 (GRCm39) missense unknown
R7797:Kmt2d UTSW 15 98,762,287 (GRCm39) missense probably benign 0.24
R7803:Kmt2d UTSW 15 98,760,804 (GRCm39) missense unknown
R7952:Kmt2d UTSW 15 98,748,649 (GRCm39) missense unknown
R8054:Kmt2d UTSW 15 98,741,806 (GRCm39) missense unknown
R8084:Kmt2d UTSW 15 98,739,945 (GRCm39) missense unknown
R8089:Kmt2d UTSW 15 98,740,750 (GRCm39) missense unknown
R8133:Kmt2d UTSW 15 98,762,823 (GRCm39) missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98,741,534 (GRCm39) missense unknown
R8343:Kmt2d UTSW 15 98,750,478 (GRCm39) missense unknown
R8681:Kmt2d UTSW 15 98,743,948 (GRCm39) missense unknown
R8694:Kmt2d UTSW 15 98,742,615 (GRCm39) missense unknown
R8837:Kmt2d UTSW 15 98,762,048 (GRCm39) missense unknown
R8855:Kmt2d UTSW 15 98,754,237 (GRCm39) missense unknown
R8934:Kmt2d UTSW 15 98,759,767 (GRCm39) missense unknown
R9100:Kmt2d UTSW 15 98,747,832 (GRCm39) missense unknown
R9158:Kmt2d UTSW 15 98,741,020 (GRCm39) missense unknown
R9190:Kmt2d UTSW 15 98,749,896 (GRCm39) missense unknown
R9222:Kmt2d UTSW 15 98,747,324 (GRCm39) missense unknown
R9263:Kmt2d UTSW 15 98,747,499 (GRCm39) frame shift probably null
R9336:Kmt2d UTSW 15 98,743,697 (GRCm39) missense unknown
R9397:Kmt2d UTSW 15 98,747,994 (GRCm39) missense unknown
R9415:Kmt2d UTSW 15 98,737,586 (GRCm39) missense unknown
R9482:Kmt2d UTSW 15 98,763,046 (GRCm39) missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98,737,649 (GRCm39) missense unknown
R9610:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9611:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9611:Kmt2d UTSW 15 98,743,054 (GRCm39) unclassified probably benign
R9612:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9613:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9644:Kmt2d UTSW 15 98,743,385 (GRCm39) missense unknown
R9716:Kmt2d UTSW 15 98,741,283 (GRCm39) missense unknown
R9763:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9782:Kmt2d UTSW 15 98,764,597 (GRCm39) missense probably damaging 1.00
X0018:Kmt2d UTSW 15 98,750,803 (GRCm39) unclassified probably benign
X0024:Kmt2d UTSW 15 98,750,934 (GRCm39) unclassified probably benign
X0062:Kmt2d UTSW 15 98,747,700 (GRCm39) unclassified probably benign
Z1187:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1188:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1189:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1190:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1192:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAAAGTATCTGCAAGCTGGGC -3'
(R):5'- TACAGTGGGTCAACTTCGAGC -3'

Sequencing Primer
(F):5'- AGCAGCAGGTGAGACCCTC -3'
(R):5'- GGTCAACTTCGAGCACAGC -3'
Posted On 2019-06-26