Incidental Mutation 'R7252:Slc39a6'
ID564037
Institutional Source Beutler Lab
Gene Symbol Slc39a6
Ensembl Gene ENSMUSG00000024270
Gene Namesolute carrier family 39 (metal ion transporter), member 6
SynonymsErmelin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R7252 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24579881-24603817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24601385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 82 (N82K)
Ref Sequence ENSEMBL: ENSMUSP00000064667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120] [ENSMUST00000070726] [ENSMUST00000152504] [ENSMUST00000154205]
Predicted Effect probably benign
Transcript: ENSMUST00000025120
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070726
AA Change: N82K

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064667
Gene: ENSMUSG00000024270
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 94 141 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
Pfam:Zip 332 753 3e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152504
Predicted Effect probably benign
Transcript: ENSMUST00000154205
SMART Domains Protein: ENSMUSP00000122151
Gene: ENSMUSG00000024270

DomainStartEndE-ValueType
Pfam:Zip 48 433 2e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele do not display any gross skin abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
A730017C20Rik A G 18: 59,066,908 probably null Het
Abcc2 T A 19: 43,827,949 I1226N probably damaging Het
Adarb2 A G 13: 8,570,180 E234G probably benign Het
Ankrd52 T C 10: 128,381,996 S282P probably damaging Het
Arhgef12 A T 9: 43,015,909 S306R probably benign Het
Baiap2 G T 11: 120,003,039 A514S probably benign Het
BC030500 T A 8: 58,911,804 probably null Het
C1qtnf12 T A 4: 155,962,615 W13R unknown Het
C87977 T C 4: 144,212,940 D9G possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Cct8 T C 16: 87,484,919 E485G probably benign Het
Cep85 T C 4: 134,148,031 D542G probably benign Het
Clhc1 T A 11: 29,563,937 S340R probably benign Het
Cnot4 A T 6: 35,069,427 D168E probably damaging Het
Cntn5 G A 9: 9,831,635 T375I probably benign Het
Ctc1 T A 11: 69,026,174 I298N probably damaging Het
Dchs2 T A 3: 83,325,303 N2198K probably benign Het
Ddx6 G A 9: 44,623,753 probably null Het
Defb11 A G 8: 21,905,457 I68T probably benign Het
Dip2a C T 10: 76,273,202 V1212I not run Het
Dopey1 T A 9: 86,500,821 I269N probably damaging Het
Efna3 C T 3: 89,316,664 G73S possibly damaging Het
Fam98b C G 2: 117,263,892 R228G probably damaging Het
Fancd2 A T 6: 113,556,285 N521I probably damaging Het
Farsa A G 8: 84,861,328 D134G probably damaging Het
Fat2 A T 11: 55,311,262 F329I probably damaging Het
Gm14399 A T 2: 175,133,198 I43K probably damaging Het
Gpr15 A G 16: 58,718,397 S110P probably damaging Het
Gpr157 T C 4: 150,098,874 V167A probably benign Het
Hacd4 A G 4: 88,426,763 I134T possibly damaging Het
Hpgd T A 8: 56,298,426 N96K probably damaging Het
Insm2 A T 12: 55,600,520 T350S probably benign Het
Iqch C T 9: 63,512,236 probably null Het
Kmt2d A G 15: 98,844,266 S4338P unknown Het
Krtap9-3 A G 11: 99,597,970 S29P probably benign Het
Kyat3 T A 3: 142,720,458 S87T probably benign Het
Mrpl46 T C 7: 78,780,588 T145A probably benign Het
Neb A G 2: 52,324,961 probably null Het
Olfr1232 T A 2: 89,326,285 probably benign Het
Olfr170 A T 16: 19,606,499 H55Q probably damaging Het
Olfr461 A G 6: 40,544,769 I70T probably benign Het
Olfr829 A G 9: 18,857,252 Y200C probably damaging Het
Olfr986 C T 9: 40,187,361 T82I probably benign Het
Otogl T C 10: 107,821,943 D1042G probably benign Het
Paxip1 C T 5: 27,760,086 V659I probably damaging Het
Pfkl A G 10: 77,993,429 W382R probably damaging Het
Pfn1 A G 11: 70,654,471 W4R probably damaging Het
Pik3c2b G A 1: 133,094,734 R1138H probably benign Het
Pkd1l3 A G 8: 109,660,698 D1758G probably benign Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prdm12 A G 2: 31,642,374 N132S possibly damaging Het
Prokr2 T A 2: 132,381,440 M61L probably benign Het
Ralgapa2 T C 2: 146,342,751 probably null Het
Ralgps1 A T 2: 33,168,188 D301E probably benign Het
Rcbtb2 T C 14: 73,166,780 Y231H probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Relb C A 7: 19,612,613 E345* probably null Het
Rhbdl3 A C 11: 80,337,585 M294L possibly damaging Het
Rpl24 G A 16: 55,970,116 A112T possibly damaging Het
Rsbn1l C T 5: 20,908,198 R442Q probably damaging Het
Rxfp3 A T 15: 11,035,939 I449N probably benign Het
Sema4c A C 1: 36,550,015 C677G probably damaging Het
Sf3b3 A C 8: 110,839,930 I256S probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slc3a2 T C 19: 8,723,157 probably benign Het
Stard13 T C 5: 151,063,169 Q292R probably benign Het
Tgm6 A G 2: 130,144,964 R451G probably damaging Het
Tspo G T 15: 83,572,265 G83V probably damaging Het
Ubxn10 T C 4: 138,720,876 Q163R probably benign Het
Ushbp1 A G 8: 71,394,602 S129P probably benign Het
Vmn2r23 T A 6: 123,741,581 V631D probably damaging Het
Vmn2r24 T C 6: 123,787,232 I356T possibly damaging Het
Vmn2r84 C T 10: 130,386,410 C647Y probably damaging Het
Vps13a T C 19: 16,661,064 E2356G probably benign Het
Wdr64 A G 1: 175,775,674 T614A probably benign Het
Zdhhc16 G T 19: 41,941,551 W271L probably damaging Het
Zer1 A C 2: 30,101,892 S652A probably damaging Het
Zfp287 A G 11: 62,724,829 V224A probably damaging Het
Zfp438 A T 18: 5,214,874 L28* probably null Het
Zfp830 G A 11: 82,764,708 A113T probably benign Het
Zfp865 G T 7: 5,034,417 probably benign Het
Other mutations in Slc39a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Slc39a6 APN 18 24589745 critical splice donor site probably null
IGL01412:Slc39a6 APN 18 24585356 missense probably damaging 1.00
IGL02182:Slc39a6 APN 18 24601290 missense probably damaging 0.99
IGL02332:Slc39a6 APN 18 24589823 missense probably benign 0.22
IGL02648:Slc39a6 APN 18 24582367 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0729:Slc39a6 UTSW 18 24601470 missense probably benign 0.00
R1128:Slc39a6 UTSW 18 24585292 missense probably damaging 1.00
R1621:Slc39a6 UTSW 18 24600889 missense probably benign 0.08
R1799:Slc39a6 UTSW 18 24585467 missense probably benign 0.00
R1800:Slc39a6 UTSW 18 24585202 missense probably damaging 1.00
R1885:Slc39a6 UTSW 18 24601482 unclassified probably null
R4159:Slc39a6 UTSW 18 24597828 missense possibly damaging 0.88
R4809:Slc39a6 UTSW 18 24585474 nonsense probably null
R4903:Slc39a6 UTSW 18 24597868 missense probably damaging 1.00
R4994:Slc39a6 UTSW 18 24596294 missense probably damaging 1.00
R5352:Slc39a6 UTSW 18 24601036 missense probably benign 0.00
R5398:Slc39a6 UTSW 18 24597879 missense probably damaging 1.00
R5832:Slc39a6 UTSW 18 24601612 missense possibly damaging 0.81
R6182:Slc39a6 UTSW 18 24600956 missense probably benign 0.16
R6853:Slc39a6 UTSW 18 24599319 missense possibly damaging 0.71
R7226:Slc39a6 UTSW 18 24584027 missense probably damaging 1.00
R7263:Slc39a6 UTSW 18 24601203 missense probably benign
R7328:Slc39a6 UTSW 18 24600930 missense probably benign 0.00
R7388:Slc39a6 UTSW 18 24584049 missense probably damaging 1.00
R7395:Slc39a6 UTSW 18 24585275 missense probably damaging 1.00
X0065:Slc39a6 UTSW 18 24585375 missense possibly damaging 0.95
Z1176:Slc39a6 UTSW 18 24585315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCAGCAACCGTGTGACTG -3'
(R):5'- TTGCCCTTTGGGTTACAAGCC -3'

Sequencing Primer
(F):5'- AACCGTGTGACTGCGGTG -3'
(R):5'- GGGTTACAAGCCCCCTTCATG -3'
Posted On2019-06-26