Incidental Mutation 'R7252:Vps13a'
ID564040
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7252 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16661064 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2356 (E2356G)
Ref Sequence ENSEMBL: ENSMUSP00000068716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect probably benign
Transcript: ENSMUST00000068156
AA Change: E2356G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: E2356G

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224149
Predicted Effect
Meta Mutation Damage Score 0.2275 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (81/82)
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
A730017C20Rik A G 18: 59,066,908 probably null Het
Abcc2 T A 19: 43,827,949 I1226N probably damaging Het
Adarb2 A G 13: 8,570,180 E234G probably benign Het
Ankrd52 T C 10: 128,381,996 S282P probably damaging Het
Arhgef12 A T 9: 43,015,909 S306R probably benign Het
Baiap2 G T 11: 120,003,039 A514S probably benign Het
BC030500 T A 8: 58,911,804 probably null Het
C1qtnf12 T A 4: 155,962,615 W13R unknown Het
C87977 T C 4: 144,212,940 D9G possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Cct8 T C 16: 87,484,919 E485G probably benign Het
Cep85 T C 4: 134,148,031 D542G probably benign Het
Clhc1 T A 11: 29,563,937 S340R probably benign Het
Cnot4 A T 6: 35,069,427 D168E probably damaging Het
Cntn5 G A 9: 9,831,635 T375I probably benign Het
Ctc1 T A 11: 69,026,174 I298N probably damaging Het
Dchs2 T A 3: 83,325,303 N2198K probably benign Het
Ddx6 G A 9: 44,623,753 probably null Het
Defb11 A G 8: 21,905,457 I68T probably benign Het
Dip2a C T 10: 76,273,202 V1212I not run Het
Dopey1 T A 9: 86,500,821 I269N probably damaging Het
Efna3 C T 3: 89,316,664 G73S possibly damaging Het
Fam98b C G 2: 117,263,892 R228G probably damaging Het
Fancd2 A T 6: 113,556,285 N521I probably damaging Het
Farsa A G 8: 84,861,328 D134G probably damaging Het
Fat2 A T 11: 55,311,262 F329I probably damaging Het
Gm14399 A T 2: 175,133,198 I43K probably damaging Het
Gpr15 A G 16: 58,718,397 S110P probably damaging Het
Gpr157 T C 4: 150,098,874 V167A probably benign Het
Hacd4 A G 4: 88,426,763 I134T possibly damaging Het
Hpgd T A 8: 56,298,426 N96K probably damaging Het
Insm2 A T 12: 55,600,520 T350S probably benign Het
Iqch C T 9: 63,512,236 probably null Het
Kmt2d A G 15: 98,844,266 S4338P unknown Het
Krtap9-3 A G 11: 99,597,970 S29P probably benign Het
Kyat3 T A 3: 142,720,458 S87T probably benign Het
Mrpl46 T C 7: 78,780,588 T145A probably benign Het
Neb A G 2: 52,324,961 probably null Het
Olfr1232 T A 2: 89,326,285 probably benign Het
Olfr170 A T 16: 19,606,499 H55Q probably damaging Het
Olfr461 A G 6: 40,544,769 I70T probably benign Het
Olfr829 A G 9: 18,857,252 Y200C probably damaging Het
Olfr986 C T 9: 40,187,361 T82I probably benign Het
Otogl T C 10: 107,821,943 D1042G probably benign Het
Paxip1 C T 5: 27,760,086 V659I probably damaging Het
Pfkl A G 10: 77,993,429 W382R probably damaging Het
Pfn1 A G 11: 70,654,471 W4R probably damaging Het
Pik3c2b G A 1: 133,094,734 R1138H probably benign Het
Pkd1l3 A G 8: 109,660,698 D1758G probably benign Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prdm12 A G 2: 31,642,374 N132S possibly damaging Het
Prokr2 T A 2: 132,381,440 M61L probably benign Het
Ralgapa2 T C 2: 146,342,751 probably null Het
Ralgps1 A T 2: 33,168,188 D301E probably benign Het
Rcbtb2 T C 14: 73,166,780 Y231H probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Relb C A 7: 19,612,613 E345* probably null Het
Rhbdl3 A C 11: 80,337,585 M294L possibly damaging Het
Rpl24 G A 16: 55,970,116 A112T possibly damaging Het
Rsbn1l C T 5: 20,908,198 R442Q probably damaging Het
Rxfp3 A T 15: 11,035,939 I449N probably benign Het
Sema4c A C 1: 36,550,015 C677G probably damaging Het
Sf3b3 A C 8: 110,839,930 I256S probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slc39a6 G T 18: 24,601,385 N82K possibly damaging Het
Slc3a2 T C 19: 8,723,157 probably benign Het
Stard13 T C 5: 151,063,169 Q292R probably benign Het
Tgm6 A G 2: 130,144,964 R451G probably damaging Het
Tspo G T 15: 83,572,265 G83V probably damaging Het
Ubxn10 T C 4: 138,720,876 Q163R probably benign Het
Ushbp1 A G 8: 71,394,602 S129P probably benign Het
Vmn2r23 T A 6: 123,741,581 V631D probably damaging Het
Vmn2r24 T C 6: 123,787,232 I356T possibly damaging Het
Vmn2r84 C T 10: 130,386,410 C647Y probably damaging Het
Wdr64 A G 1: 175,775,674 T614A probably benign Het
Zdhhc16 G T 19: 41,941,551 W271L probably damaging Het
Zer1 A C 2: 30,101,892 S652A probably damaging Het
Zfp287 A G 11: 62,724,829 V224A probably damaging Het
Zfp438 A T 18: 5,214,874 L28* probably null Het
Zfp830 G A 11: 82,764,708 A113T probably benign Het
Zfp865 G T 7: 5,034,417 probably benign Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 intron probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1114:Vps13a UTSW 19 16750151 missense probably benign 0.41
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3081:Vps13a UTSW 19 16664737 missense probably benign 0.02
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3797:Vps13a UTSW 19 16745947 splice site probably null
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16682110 missense probably damaging 0.98
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5182:Vps13a UTSW 19 16695499 missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5866:Vps13a UTSW 19 16680023 missense probably benign 0.04
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 intron probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCTCGACATGCCTGCCAAC -3'
(R):5'- AGAGTGCACAGCGGTTTTAG -3'

Sequencing Primer
(F):5'- ACATGCCTGCCAACTTTCTATATAAC -3'
(R):5'- CACAGCGGTTTTAGTACATGGAC -3'
Posted On2019-06-26