Mutagenetix > Incidental Mutation

Incidental Mutation 'R7253:Rapgef1'

564046

Institutional Source

Beutler Lab

Gene Symbol

Rapgef1

Ensembl Gene

ENSMUSG00000039844

Gene Name

Rap guanine nucleotide exchange factor (GEF) 1

Synonyms

Grf2, 4932418O06Rik, C3G

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7253 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29619720-29740978 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29699721 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 258 (E258G)

Ref Sequence

ENSEMBL: ENSMUSP00000092703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]

AlphaFold

Q3UHC1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091146
AA Change: E220G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: E220G

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	592	603	N/A	INTRINSIC
low complexity region	664	682	N/A	INTRINSIC
low complexity region	689	700	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
RasGEFN	828	970	8.04e-37	SMART
RasGEF	977	1206	5.85e-102	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095087
AA Change: E258G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: E258G

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
low complexity region	702	720	N/A	INTRINSIC
low complexity region	727	738	N/A	INTRINSIC
RasGEFN	834	976	8.04e-37	SMART
RasGEF	983	1212	5.85e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102872
AA Change: E258G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: E258G

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
RasGEFN	696	838	8.04e-37	SMART
RasGEF	845	1074	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147488

SMART Domains

Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC
low complexity region	54	65	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
RasGEFN	253	395	8.04e-37	SMART
RasGEF	402	631	5.85e-102	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147755
AA Change: E220G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: E220G

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	591	602	N/A	INTRINSIC
low complexity region	663	681	N/A	INTRINSIC

Meta Mutation Damage Score

0.0775

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	G	4: 39,451,391	H199R	not run	Het
Ak9	A	G	10: 41,432,484	N1804S	unknown	Het
Akr1c21	C	A	13: 4,577,140	T147N	probably damaging	Het
Aldh1a2	A	G	9: 71,215,934	T30A	probably benign	Het
Alox15	T	C	11: 70,345,898	D447G	probably damaging	Het
Amigo2	T	C	15: 97,245,075	I489V	probably benign	Het
Ano9	A	T	7: 141,107,437	Y322N	probably damaging	Het
Arhgap40	G	T	2: 158,547,656	W583L	probably benign	Het
Atxn2	A	G	5: 121,778,021	E430G	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,528	V425E	probably benign	Het
Brip1	T	C	11: 86,143,278	Y539C	possibly damaging	Het
C87436	T	A	6: 86,465,808	L454Q	probably damaging	Het
Casp4	T	G	9: 5,324,868	Y227D	probably benign	Het
Ccdc151	T	C	9: 22,002,471	T2A	probably damaging	Het
Chd4	T	A	6: 125,106,592		probably null	Het
Chrna10	A	G	7: 102,112,086	C433R	probably benign	Het
Cntln	A	T	4: 85,118,473	N214I	probably damaging	Het
Colec12	G	A	18: 9,848,922	V367I	probably damaging	Het
Cyp46a1	T	C	12: 108,351,996	I222T	probably benign	Het
Dagla	A	T	19: 10,262,581		probably null	Het
Dcaf7	C	A	11: 106,047,843		probably null	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
E2f7	A	G	10: 110,766,303		probably null	Het
Fam184a	G	T	10: 53,698,805	T236K	probably benign	Het
Fam46a	C	A	9: 85,326,717	G18C	probably benign	Het
Glyctk	T	C	9: 106,155,462	T451A	probably damaging	Het
Hectd4	A	G	5: 121,314,881	K484E	possibly damaging	Het
Hspbap1	G	T	16: 35,817,230	C243F	unknown	Het
Hspg2	A	C	4: 137,519,946	N1160T	probably benign	Het
Ighv5-8	C	T	12: 113,655,108	L48F	probably benign	Het
Jazf1	C	A	6: 52,777,652	E146D	probably benign	Het
Katnb1	C	T	8: 95,095,497	Q284*	probably null	Het
Kctd18	G	T	1: 57,961,956	Y213*	probably null	Het
Klk1b26	T	C	7: 44,014,789	S23P	possibly damaging	Het
Krt88	T	C	15: 101,450,511	L26P	probably damaging	Het
Lrrc8b	G	A	5: 105,481,656	V623I	probably benign	Het
Map3k4	T	A	17: 12,272,068	M159L	probably benign	Het
Mast3	C	A	8: 70,789,682		probably null	Het
Mier1	G	A	4: 103,139,347		probably null	Het
Mrpl46	T	C	7: 78,781,459	D117G	probably damaging	Het
Ms4a6b	A	G	19: 11,520,396	S20G	probably benign	Het
Mup10	A	T	4: 60,582,078	M4K	unknown	Het
Nlrp5	C	T	7: 23,417,391	A180V	possibly damaging	Het
Nlrx1	T	A	9: 44,264,704		probably null	Het
Olfr1195	T	C	2: 88,683,625	T36A	possibly damaging	Het
Olfr313	T	A	11: 58,817,540	C177*	probably null	Het
Olfr315	T	C	11: 58,778,996	Y290H	probably damaging	Het
Olfr437	T	C	6: 43,167,810	F251L	probably damaging	Het
Olfr612	C	T	7: 103,538,788	A149T	probably benign	Het
Olfr992	A	G	2: 85,399,639	I298T	probably benign	Het
Otud1	C	A	2: 19,658,931	D290E	probably damaging	Het
Pank4	A	G	4: 154,970,920	N249S	probably benign	Het
Pccb	G	T	9: 101,031,913	S84R	probably benign	Het
Pemt	A	T	11: 59,971,255	H194Q	possibly damaging	Het
Phtf2	A	G	5: 20,765,858	I634T	possibly damaging	Het
Pias2	T	G	18: 77,120,115	I232R	probably damaging	Het
Plce1	A	G	19: 38,698,508	E620G	probably damaging	Het
Ptpn13	G	A	5: 103,565,284	E1758K	possibly damaging	Het
Ptprq	T	A	10: 107,608,273	Q1490L	probably benign	Het
Ptx3	G	T	3: 66,224,947	M296I	probably benign	Het
R3hdm2	C	T	10: 127,481,775	P464L	probably damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,915		probably benign	Het
Senp8	T	C	9: 59,737,195	N226S	probably benign	Het
Six5	C	T	7: 19,094,976	R114C	probably damaging	Het
Slc10a1	T	C	12: 80,958,184	T195A	probably benign	Het
Slpi	G	T	2: 164,355,547	Q51K	probably benign	Het
Smarca4	T	C	9: 21,658,960	V753A	probably benign	Het
Tbc1d32	C	A	10: 56,198,441	M225I	probably benign	Het
Tnfrsf21	G	A	17: 43,037,667	V57I	probably benign	Het
Trim44	G	T	2: 102,346,968	P336T	possibly damaging	Het
Txlnb	A	G	10: 17,827,885	I264V	probably damaging	Het
Wisp3	T	G	10: 39,155,035	N164T	probably benign	Het
Xirp2	A	C	2: 67,513,482	E2022D	probably benign	Het
Zfp975	A	G	7: 42,661,612	*526R	probably null	Het
Zp1	A	G	19: 10,916,569	L424P	probably damaging	Het

Other mutations in Rapgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Rapgef1	APN	2	29722269	missense	probably benign
IGL00917:Rapgef1	APN	2	29702523	missense	probably benign	0.00
IGL02618:Rapgef1	APN	2	29737943	missense	probably damaging	1.00
IGL02642:Rapgef1	APN	2	29700860	splice site	probably benign
IGL02974:Rapgef1	APN	2	29710216	missense	possibly damaging	0.64
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0279:Rapgef1	UTSW	2	29726227	missense	probably damaging	1.00
R0432:Rapgef1	UTSW	2	29679816	missense	possibly damaging	0.86
R1817:Rapgef1	UTSW	2	29686256	missense	probably damaging	1.00
R1837:Rapgef1	UTSW	2	29737426	missense	probably damaging	1.00
R1970:Rapgef1	UTSW	2	29733711	missense	probably damaging	1.00
R1980:Rapgef1	UTSW	2	29722227	missense	probably benign
R2076:Rapgef1	UTSW	2	29702508	missense	probably benign	0.00
R2363:Rapgef1	UTSW	2	29736596	missense	possibly damaging	0.63
R3016:Rapgef1	UTSW	2	29707393	missense	probably damaging	1.00
R3053:Rapgef1	UTSW	2	29724856	missense	probably damaging	1.00
R3777:Rapgef1	UTSW	2	29719689	missense	possibly damaging	0.67
R3980:Rapgef1	UTSW	2	29719650	missense	probably benign	0.33
R4491:Rapgef1	UTSW	2	29719656	missense	possibly damaging	0.93
R4524:Rapgef1	UTSW	2	29679246	missense	probably benign	0.00
R4732:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R4733:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R5391:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5395:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5611:Rapgef1	UTSW	2	29702436	missense	probably damaging	0.96
R6062:Rapgef1	UTSW	2	29700732	missense	probably damaging	0.96
R6145:Rapgef1	UTSW	2	29736666	missense	probably damaging	1.00
R6580:Rapgef1	UTSW	2	29730609	missense	possibly damaging	0.95
R6892:Rapgef1	UTSW	2	29699840	critical splice donor site	probably null
R6897:Rapgef1	UTSW	2	29702502	missense	probably damaging	1.00
R6957:Rapgef1	UTSW	2	29733698	missense	possibly damaging	0.62
R7039:Rapgef1	UTSW	2	29726214	missense	probably damaging	0.97
R7149:Rapgef1	UTSW	2	29720700	missense	probably damaging	0.98
R7315:Rapgef1	UTSW	2	29734492	missense	probably damaging	0.98
R7956:Rapgef1	UTSW	2	29699015	missense	probably benign	0.03
R8161:Rapgef1	UTSW	2	29679198	missense	probably benign	0.08
R8162:Rapgef1	UTSW	2	29735999	missense	probably damaging	0.99
R8372:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
R8373:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
R8485:Rapgef1	UTSW	2	29710174	missense	probably damaging	1.00
R8838:Rapgef1	UTSW	2	29737446	missense	possibly damaging	0.77
R9484:Rapgef1	UTSW	2	29735809	missense	possibly damaging	0.95
R9521:Rapgef1	UTSW	2	29734279	missense	probably benign	0.16
RF005:Rapgef1	UTSW	2	29707195	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TTTAGAGCATCCTGGTAGCTGG -3'
(R):5'- CAGGCACAGTTATCCTTCAGC -3'

Sequencing Primer
(F):5'- CTGGTCAGTGATGAAACGCC -3'
(R):5'- GGCACAGTTATCCTTCAGCTCATTC -3'

Posted On

2019-06-26