Incidental Mutation 'R7253:Pank4'
ID564060
Institutional Source Beutler Lab
Gene Symbol Pank4
Ensembl Gene ENSMUSG00000029056
Gene Namepantothenate kinase 4
SynonymsD030031I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7253 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154964123-154980938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154970920 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 249 (N249S)
Ref Sequence ENSEMBL: ENSMUSP00000064330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953]
Predicted Effect probably benign
Transcript: ENSMUST00000030931
AA Change: N249S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056
AA Change: N249S

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070953
AA Change: N249S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056
AA Change: N249S

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056
AA Change: N106S

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Aldh1a2 A G 9: 71,215,934 T30A probably benign Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
B020004J07Rik A T 4: 101,835,528 V425E probably benign Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chd4 T A 6: 125,106,592 probably null Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dagla A T 19: 10,262,581 probably null Het
Dcaf7 C A 11: 106,047,843 probably null Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
E2f7 A G 10: 110,766,303 probably null Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Glyctk T C 9: 106,155,462 T451A probably damaging Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspbap1 G T 16: 35,817,230 C243F unknown Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mast3 C A 8: 70,789,682 probably null Het
Mier1 G A 4: 103,139,347 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Nlrx1 T A 9: 44,264,704 probably null Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptpn13 G A 5: 103,565,284 E1758K possibly damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in Pank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Pank4 APN 4 154980602 missense possibly damaging 0.50
IGL01105:Pank4 APN 4 154972465 splice site probably benign
IGL01291:Pank4 APN 4 154974646 missense probably damaging 0.98
IGL01935:Pank4 APN 4 154979530 missense probably damaging 1.00
IGL02366:Pank4 APN 4 154969628 missense probably benign 0.03
IGL02514:Pank4 APN 4 154970465 missense probably damaging 0.99
IGL03028:Pank4 APN 4 154969985 unclassified probably benign
IGL03033:Pank4 APN 4 154974715 missense probably damaging 1.00
ANU05:Pank4 UTSW 4 154974646 missense probably damaging 0.98
R0518:Pank4 UTSW 4 154976625 missense possibly damaging 0.90
R1196:Pank4 UTSW 4 154978173 missense probably damaging 0.99
R1566:Pank4 UTSW 4 154980521 missense probably damaging 0.98
R1581:Pank4 UTSW 4 154974651 missense probably damaging 1.00
R1709:Pank4 UTSW 4 154970047 missense probably damaging 1.00
R1852:Pank4 UTSW 4 154976359 missense probably damaging 1.00
R1950:Pank4 UTSW 4 154972520 missense probably benign
R2943:Pank4 UTSW 4 154971474 missense probably benign 0.01
R3911:Pank4 UTSW 4 154969601 missense probably damaging 1.00
R4162:Pank4 UTSW 4 154979594 critical splice donor site probably null
R4404:Pank4 UTSW 4 154980156 missense probably benign 0.00
R4619:Pank4 UTSW 4 154976619 missense probably benign 0.07
R4731:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4732:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4733:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4747:Pank4 UTSW 4 154979532 missense probably damaging 1.00
R4760:Pank4 UTSW 4 154974634 missense possibly damaging 0.60
R5218:Pank4 UTSW 4 154979728 missense probably benign 0.01
R5278:Pank4 UTSW 4 154972165 missense probably damaging 1.00
R5774:Pank4 UTSW 4 154980662 missense probably damaging 1.00
R6004:Pank4 UTSW 4 154977221 missense probably damaging 1.00
R6376:Pank4 UTSW 4 154972236 splice site probably null
R7105:Pank4 UTSW 4 154980167 missense probably benign 0.07
R7481:Pank4 UTSW 4 154970038 missense probably damaging 1.00
R7565:Pank4 UTSW 4 154980550 missense probably benign 0.08
R7718:Pank4 UTSW 4 154974643 missense probably damaging 1.00
R7736:Pank4 UTSW 4 154969747 missense probably benign 0.03
R8144:Pank4 UTSW 4 154970080 missense probably benign 0.01
Z1177:Pank4 UTSW 4 154974745 missense probably damaging 1.00
Z1177:Pank4 UTSW 4 154974784 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTGAACTGCCGGAGCTCTG -3'
(R):5'- TGATGTCCTGGGCACTGAAG -3'

Sequencing Primer
(F):5'- AGCTCAGTGGTCCAGCATCTAG -3'
(R):5'- ACTGAAGCTGGCTGTGGC -3'
Posted On2019-06-26