Incidental Mutation 'R7253:Mast3'
ID564078
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7253 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 70789682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
Predicted Effect probably benign
Transcript: ENSMUST00000166004
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211948
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably null
Transcript: ENSMUST00000212551
Predicted Effect probably null
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Aldh1a2 A G 9: 71,215,934 T30A probably benign Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
B020004J07Rik A T 4: 101,835,528 V425E probably benign Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chd4 T A 6: 125,106,592 probably null Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dagla A T 19: 10,262,581 probably null Het
Dcaf7 C A 11: 106,047,843 probably null Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
E2f7 A G 10: 110,766,303 probably null Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Glyctk T C 9: 106,155,462 T451A probably damaging Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspbap1 G T 16: 35,817,230 C243F unknown Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mier1 G A 4: 103,139,347 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Nlrx1 T A 9: 44,264,704 probably null Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pank4 A G 4: 154,970,920 N249S probably benign Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptpn13 G A 5: 103,565,284 E1758K possibly damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAACTCAGGGATATCCAAGGG -3'
(R):5'- TCGGAACTTCTCTGCTGCAG -3'

Sequencing Primer
(F):5'- TTGGTGGCTCAATCCTTG -3'
(R):5'- GCAGCAGCCATCAGTTTCC -3'
Posted On2019-06-26