Mutagenetix > Incidental Mutation

Incidental Mutation 'R7253:Mast3'

564078

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7253 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 70789682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211948

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably null
Transcript: ENSMUST00000212551

Predicted Effect

probably null
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (74/75)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	G	4: 39,451,391	H199R	not run	Het
Ak9	A	G	10: 41,432,484	N1804S	unknown	Het
Akr1c21	C	A	13: 4,577,140	T147N	probably damaging	Het
Aldh1a2	A	G	9: 71,215,934	T30A	probably benign	Het
Alox15	T	C	11: 70,345,898	D447G	probably damaging	Het
Amigo2	T	C	15: 97,245,075	I489V	probably benign	Het
Ano9	A	T	7: 141,107,437	Y322N	probably damaging	Het
Arhgap40	G	T	2: 158,547,656	W583L	probably benign	Het
Atxn2	A	G	5: 121,778,021	E430G	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,528	V425E	probably benign	Het
Brip1	T	C	11: 86,143,278	Y539C	possibly damaging	Het
C87436	T	A	6: 86,465,808	L454Q	probably damaging	Het
Casp4	T	G	9: 5,324,868	Y227D	probably benign	Het
Ccdc151	T	C	9: 22,002,471	T2A	probably damaging	Het
Chd4	T	A	6: 125,106,592		probably null	Het
Chrna10	A	G	7: 102,112,086	C433R	probably benign	Het
Cntln	A	T	4: 85,118,473	N214I	probably damaging	Het
Colec12	G	A	18: 9,848,922	V367I	probably damaging	Het
Cyp46a1	T	C	12: 108,351,996	I222T	probably benign	Het
Dagla	A	T	19: 10,262,581		probably null	Het
Dcaf7	C	A	11: 106,047,843		probably null	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
E2f7	A	G	10: 110,766,303		probably null	Het
Fam184a	G	T	10: 53,698,805	T236K	probably benign	Het
Fam46a	C	A	9: 85,326,717	G18C	probably benign	Het
Glyctk	T	C	9: 106,155,462	T451A	probably damaging	Het
Hectd4	A	G	5: 121,314,881	K484E	possibly damaging	Het
Hspbap1	G	T	16: 35,817,230	C243F	unknown	Het
Hspg2	A	C	4: 137,519,946	N1160T	probably benign	Het
Ighv5-8	C	T	12: 113,655,108	L48F	probably benign	Het
Jazf1	C	A	6: 52,777,652	E146D	probably benign	Het
Katnb1	C	T	8: 95,095,497	Q284*	probably null	Het
Kctd18	G	T	1: 57,961,956	Y213*	probably null	Het
Klk1b26	T	C	7: 44,014,789	S23P	possibly damaging	Het
Krt88	T	C	15: 101,450,511	L26P	probably damaging	Het
Lrrc8b	G	A	5: 105,481,656	V623I	probably benign	Het
Map3k4	T	A	17: 12,272,068	M159L	probably benign	Het
Mier1	G	A	4: 103,139,347		probably null	Het
Mrpl46	T	C	7: 78,781,459	D117G	probably damaging	Het
Ms4a6b	A	G	19: 11,520,396	S20G	probably benign	Het
Mup10	A	T	4: 60,582,078	M4K	unknown	Het
Nlrp5	C	T	7: 23,417,391	A180V	possibly damaging	Het
Nlrx1	T	A	9: 44,264,704		probably null	Het
Olfr1195	T	C	2: 88,683,625	T36A	possibly damaging	Het
Olfr313	T	A	11: 58,817,540	C177*	probably null	Het
Olfr315	T	C	11: 58,778,996	Y290H	probably damaging	Het
Olfr437	T	C	6: 43,167,810	F251L	probably damaging	Het
Olfr612	C	T	7: 103,538,788	A149T	probably benign	Het
Olfr992	A	G	2: 85,399,639	I298T	probably benign	Het
Otud1	C	A	2: 19,658,931	D290E	probably damaging	Het
Pank4	A	G	4: 154,970,920	N249S	probably benign	Het
Pccb	G	T	9: 101,031,913	S84R	probably benign	Het
Pemt	A	T	11: 59,971,255	H194Q	possibly damaging	Het
Phtf2	A	G	5: 20,765,858	I634T	possibly damaging	Het
Pias2	T	G	18: 77,120,115	I232R	probably damaging	Het
Plce1	A	G	19: 38,698,508	E620G	probably damaging	Het
Ptpn13	G	A	5: 103,565,284	E1758K	possibly damaging	Het
Ptprq	T	A	10: 107,608,273	Q1490L	probably benign	Het
Ptx3	G	T	3: 66,224,947	M296I	probably benign	Het
R3hdm2	C	T	10: 127,481,775	P464L	probably damaging	Het
Rapgef1	A	G	2: 29,699,721	E258G	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,915		probably benign	Het
Senp8	T	C	9: 59,737,195	N226S	probably benign	Het
Six5	C	T	7: 19,094,976	R114C	probably damaging	Het
Slc10a1	T	C	12: 80,958,184	T195A	probably benign	Het
Slpi	G	T	2: 164,355,547	Q51K	probably benign	Het
Smarca4	T	C	9: 21,658,960	V753A	probably benign	Het
Tbc1d32	C	A	10: 56,198,441	M225I	probably benign	Het
Tnfrsf21	G	A	17: 43,037,667	V57I	probably benign	Het
Trim44	G	T	2: 102,346,968	P336T	possibly damaging	Het
Txlnb	A	G	10: 17,827,885	I264V	probably damaging	Het
Wisp3	T	G	10: 39,155,035	N164T	probably benign	Het
Xirp2	A	C	2: 67,513,482	E2022D	probably benign	Het
Zfp975	A	G	7: 42,661,612	*526R	probably null	Het
Zp1	A	G	19: 10,916,569	L424P	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAACTCAGGGATATCCAAGGG -3'
(R):5'- TCGGAACTTCTCTGCTGCAG -3'

Sequencing Primer
(F):5'- TTGGTGGCTCAATCCTTG -3'
(R):5'- GCAGCAGCCATCAGTTTCC -3'

Posted On

2019-06-26