Mutagenetix > Incidental Mutation

Incidental Mutation 'R7253:Tbc1d32'

564092

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.886) question?

Stock #

R7253 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 56198441 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 225 (M225I)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

AlphaFold

Q3URV1

Predicted Effect

probably benign
Transcript: ENSMUST00000099739
AA Change: M225I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: M225I

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	G	4: 39,451,391	H199R	not run	Het
Ak9	A	G	10: 41,432,484	N1804S	unknown	Het
Akr1c21	C	A	13: 4,577,140	T147N	probably damaging	Het
Aldh1a2	A	G	9: 71,215,934	T30A	probably benign	Het
Alox15	T	C	11: 70,345,898	D447G	probably damaging	Het
Amigo2	T	C	15: 97,245,075	I489V	probably benign	Het
Ano9	A	T	7: 141,107,437	Y322N	probably damaging	Het
Arhgap40	G	T	2: 158,547,656	W583L	probably benign	Het
Atxn2	A	G	5: 121,778,021	E430G	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,528	V425E	probably benign	Het
Brip1	T	C	11: 86,143,278	Y539C	possibly damaging	Het
C87436	T	A	6: 86,465,808	L454Q	probably damaging	Het
Casp4	T	G	9: 5,324,868	Y227D	probably benign	Het
Ccdc151	T	C	9: 22,002,471	T2A	probably damaging	Het
Chd4	T	A	6: 125,106,592		probably null	Het
Chrna10	A	G	7: 102,112,086	C433R	probably benign	Het
Cntln	A	T	4: 85,118,473	N214I	probably damaging	Het
Colec12	G	A	18: 9,848,922	V367I	probably damaging	Het
Cyp46a1	T	C	12: 108,351,996	I222T	probably benign	Het
Dagla	A	T	19: 10,262,581		probably null	Het
Dcaf7	C	A	11: 106,047,843		probably null	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
E2f7	A	G	10: 110,766,303		probably null	Het
Fam184a	G	T	10: 53,698,805	T236K	probably benign	Het
Fam46a	C	A	9: 85,326,717	G18C	probably benign	Het
Glyctk	T	C	9: 106,155,462	T451A	probably damaging	Het
Hectd4	A	G	5: 121,314,881	K484E	possibly damaging	Het
Hspbap1	G	T	16: 35,817,230	C243F	unknown	Het
Hspg2	A	C	4: 137,519,946	N1160T	probably benign	Het
Ighv5-8	C	T	12: 113,655,108	L48F	probably benign	Het
Jazf1	C	A	6: 52,777,652	E146D	probably benign	Het
Katnb1	C	T	8: 95,095,497	Q284*	probably null	Het
Kctd18	G	T	1: 57,961,956	Y213*	probably null	Het
Klk1b26	T	C	7: 44,014,789	S23P	possibly damaging	Het
Krt88	T	C	15: 101,450,511	L26P	probably damaging	Het
Lrrc8b	G	A	5: 105,481,656	V623I	probably benign	Het
Map3k4	T	A	17: 12,272,068	M159L	probably benign	Het
Mast3	C	A	8: 70,789,682		probably null	Het
Mier1	G	A	4: 103,139,347		probably null	Het
Mrpl46	T	C	7: 78,781,459	D117G	probably damaging	Het
Ms4a6b	A	G	19: 11,520,396	S20G	probably benign	Het
Mup10	A	T	4: 60,582,078	M4K	unknown	Het
Nlrp5	C	T	7: 23,417,391	A180V	possibly damaging	Het
Nlrx1	T	A	9: 44,264,704		probably null	Het
Olfr1195	T	C	2: 88,683,625	T36A	possibly damaging	Het
Olfr313	T	A	11: 58,817,540	C177*	probably null	Het
Olfr315	T	C	11: 58,778,996	Y290H	probably damaging	Het
Olfr437	T	C	6: 43,167,810	F251L	probably damaging	Het
Olfr612	C	T	7: 103,538,788	A149T	probably benign	Het
Olfr992	A	G	2: 85,399,639	I298T	probably benign	Het
Otud1	C	A	2: 19,658,931	D290E	probably damaging	Het
Pank4	A	G	4: 154,970,920	N249S	probably benign	Het
Pccb	G	T	9: 101,031,913	S84R	probably benign	Het
Pemt	A	T	11: 59,971,255	H194Q	possibly damaging	Het
Phtf2	A	G	5: 20,765,858	I634T	possibly damaging	Het
Pias2	T	G	18: 77,120,115	I232R	probably damaging	Het
Plce1	A	G	19: 38,698,508	E620G	probably damaging	Het
Ptpn13	G	A	5: 103,565,284	E1758K	possibly damaging	Het
Ptprq	T	A	10: 107,608,273	Q1490L	probably benign	Het
Ptx3	G	T	3: 66,224,947	M296I	probably benign	Het
R3hdm2	C	T	10: 127,481,775	P464L	probably damaging	Het
Rapgef1	A	G	2: 29,699,721	E258G	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,915		probably benign	Het
Senp8	T	C	9: 59,737,195	N226S	probably benign	Het
Six5	C	T	7: 19,094,976	R114C	probably damaging	Het
Slc10a1	T	C	12: 80,958,184	T195A	probably benign	Het
Slpi	G	T	2: 164,355,547	Q51K	probably benign	Het
Smarca4	T	C	9: 21,658,960	V753A	probably benign	Het
Tnfrsf21	G	A	17: 43,037,667	V57I	probably benign	Het
Trim44	G	T	2: 102,346,968	P336T	possibly damaging	Het
Txlnb	A	G	10: 17,827,885	I264V	probably damaging	Het
Wisp3	T	G	10: 39,155,035	N164T	probably benign	Het
Xirp2	A	C	2: 67,513,482	E2022D	probably benign	Het
Zfp975	A	G	7: 42,661,612	*526R	probably null	Het
Zp1	A	G	19: 10,916,569	L424P	probably damaging	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
R8864:Tbc1d32	UTSW	10	56087559	missense	probably benign	0.01
R9018:Tbc1d32	UTSW	10	56072597	missense	probably benign	0.02
R9030:Tbc1d32	UTSW	10	56161145	missense	possibly damaging	0.92
R9530:Tbc1d32	UTSW	10	56196411	missense	probably damaging	0.98
R9616:Tbc1d32	UTSW	10	56161150	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAAGTGGTACCCAAACCTTTTCTG -3'
(R):5'- TGGCTGCTCTACCCTTTAGTAG -3'

Sequencing Primer
(F):5'- CAGTATAGTAATTCCCCCACTGATG -3'
(R):5'- TGCTAATGTGTTGGAGAAATGAC -3'

Posted On

2019-06-26