Incidental Mutation 'R7253:Tbc1d32'
ID 564092
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, Bromi, b2b2284Clo, C6orf170
MMRRC Submission 045314-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R7253 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 55890389-56104785 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 56074537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 225 (M225I)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect probably benign
Transcript: ENSMUST00000099739
AA Change: M225I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: M225I

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 (GRCm39) H199R not run Het
Ak9 A G 10: 41,308,480 (GRCm39) N1804S unknown Het
Akr1c21 C A 13: 4,627,139 (GRCm39) T147N probably damaging Het
Aldh1a2 A G 9: 71,123,216 (GRCm39) T30A probably benign Het
Alox15 T C 11: 70,236,724 (GRCm39) D447G probably damaging Het
Amigo2 T C 15: 97,142,956 (GRCm39) I489V probably benign Het
Ano9 A T 7: 140,687,350 (GRCm39) Y322N probably damaging Het
Arhgap40 G T 2: 158,389,576 (GRCm39) W583L probably benign Het
Atxn2 A G 5: 121,916,084 (GRCm39) E430G probably damaging Het
Brip1 T C 11: 86,034,104 (GRCm39) Y539C possibly damaging Het
C87436 T A 6: 86,442,790 (GRCm39) L454Q probably damaging Het
Casp4 T G 9: 5,324,868 (GRCm39) Y227D probably benign Het
Ccn6 T G 10: 39,031,031 (GRCm39) N164T probably benign Het
Chd4 T A 6: 125,083,555 (GRCm39) probably null Het
Chrna10 A G 7: 101,761,293 (GRCm39) C433R probably benign Het
Cntln A T 4: 85,036,710 (GRCm39) N214I probably damaging Het
Colec12 G A 18: 9,848,922 (GRCm39) V367I probably damaging Het
Cyp46a1 T C 12: 108,318,255 (GRCm39) I222T probably benign Het
Dagla A T 19: 10,239,945 (GRCm39) probably null Het
Dcaf7 C A 11: 105,938,669 (GRCm39) probably null Het
Dclk2 C T 3: 86,700,566 (GRCm39) R638H probably damaging Het
E2f7 A G 10: 110,602,164 (GRCm39) probably null Het
Fam184a G T 10: 53,574,901 (GRCm39) T236K probably benign Het
Glyctk T C 9: 106,032,661 (GRCm39) T451A probably damaging Het
Hectd4 A G 5: 121,452,944 (GRCm39) K484E possibly damaging Het
Hspbap1 G T 16: 35,637,600 (GRCm39) C243F unknown Het
Hspg2 A C 4: 137,247,257 (GRCm39) N1160T probably benign Het
Ighv5-8 C T 12: 113,618,728 (GRCm39) L48F probably benign Het
Jazf1 C A 6: 52,754,637 (GRCm39) E146D probably benign Het
Katnb1 C T 8: 95,822,125 (GRCm39) Q284* probably null Het
Kctd18 G T 1: 58,001,115 (GRCm39) Y213* probably null Het
Klk1b26 T C 7: 43,664,213 (GRCm39) S23P possibly damaging Het
Krt88 T C 15: 101,348,392 (GRCm39) L26P probably damaging Het
Lrrc8b G A 5: 105,629,522 (GRCm39) V623I probably benign Het
Map3k4 T A 17: 12,490,955 (GRCm39) M159L probably benign Het
Mast3 C A 8: 71,242,326 (GRCm39) probably null Het
Mier1 G A 4: 102,996,544 (GRCm39) probably null Het
Mrpl46 T C 7: 78,431,207 (GRCm39) D117G probably damaging Het
Ms4a6b A G 19: 11,497,760 (GRCm39) S20G probably benign Het
Mup10 A T 4: 60,538,077 (GRCm39) M4K unknown Het
Nlrp5 C T 7: 23,116,816 (GRCm39) A180V possibly damaging Het
Nlrx1 T A 9: 44,176,001 (GRCm39) probably null Het
Odad3 T C 9: 21,913,767 (GRCm39) T2A probably damaging Het
Or2a52 T C 6: 43,144,744 (GRCm39) F251L probably damaging Het
Or2t45 T C 11: 58,669,822 (GRCm39) Y290H probably damaging Het
Or4c103 T C 2: 88,513,969 (GRCm39) T36A possibly damaging Het
Or51aa2 C T 7: 103,187,995 (GRCm39) A149T probably benign Het
Or5af2 T A 11: 58,708,366 (GRCm39) C177* probably null Het
Or5ak22 A G 2: 85,229,983 (GRCm39) I298T probably benign Het
Otud1 C A 2: 19,663,742 (GRCm39) D290E probably damaging Het
Pank4 A G 4: 155,055,377 (GRCm39) N249S probably benign Het
Pccb G T 9: 100,913,966 (GRCm39) S84R probably benign Het
Pemt A T 11: 59,862,081 (GRCm39) H194Q possibly damaging Het
Phtf2 A G 5: 20,970,856 (GRCm39) I634T possibly damaging Het
Pias2 T G 18: 77,207,811 (GRCm39) I232R probably damaging Het
Plce1 A G 19: 38,686,952 (GRCm39) E620G probably damaging Het
Pramel17 A T 4: 101,692,725 (GRCm39) V425E probably benign Het
Ptpn13 G A 5: 103,713,150 (GRCm39) E1758K possibly damaging Het
Ptprq T A 10: 107,444,134 (GRCm39) Q1490L probably benign Het
Ptx3 G T 3: 66,132,368 (GRCm39) M296I probably benign Het
R3hdm2 C T 10: 127,317,644 (GRCm39) P464L probably damaging Het
Rapgef1 A G 2: 29,589,733 (GRCm39) E258G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,122 (GRCm39) probably benign Het
Senp8 T C 9: 59,644,478 (GRCm39) N226S probably benign Het
Six5 C T 7: 18,828,901 (GRCm39) R114C probably damaging Het
Slc10a1 T C 12: 81,004,958 (GRCm39) T195A probably benign Het
Slpi G T 2: 164,197,467 (GRCm39) Q51K probably benign Het
Smarca4 T C 9: 21,570,256 (GRCm39) V753A probably benign Het
Tent5a C A 9: 85,208,770 (GRCm39) G18C probably benign Het
Tnfrsf21 G A 17: 43,348,558 (GRCm39) V57I probably benign Het
Trim44 G T 2: 102,177,313 (GRCm39) P336T possibly damaging Het
Txlnb A G 10: 17,703,633 (GRCm39) I264V probably damaging Het
Xirp2 A C 2: 67,343,826 (GRCm39) E2022D probably benign Het
Zfp975 A G 7: 42,311,036 (GRCm39) *526R probably null Het
Zp1 A G 19: 10,893,933 (GRCm39) L424P probably damaging Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56,031,861 (GRCm39) missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56,091,221 (GRCm39) splice site probably benign
IGL00835:Tbc1d32 APN 10 55,965,942 (GRCm39) splice site probably benign
IGL01013:Tbc1d32 APN 10 56,078,055 (GRCm39) splice site probably null
IGL01306:Tbc1d32 APN 10 56,056,620 (GRCm39) missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56,091,176 (GRCm39) missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 55,999,673 (GRCm39) missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56,027,871 (GRCm39) missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 55,964,499 (GRCm39) missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56,100,715 (GRCm39) missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56,074,638 (GRCm39) missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56,074,587 (GRCm39) missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 55,893,799 (GRCm39) missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56,056,620 (GRCm39) missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56,074,535 (GRCm39) missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 55,893,701 (GRCm39) missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56,068,994 (GRCm39) missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56,050,059 (GRCm39) missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56,100,736 (GRCm39) missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56,056,672 (GRCm39) missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56,037,243 (GRCm39) missense probably benign
R1432:Tbc1d32 UTSW 10 55,893,758 (GRCm39) missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56,053,575 (GRCm39) splice site probably benign
R1708:Tbc1d32 UTSW 10 56,027,865 (GRCm39) missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 55,893,700 (GRCm39) missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 55,999,633 (GRCm39) nonsense probably null
R2208:Tbc1d32 UTSW 10 56,026,888 (GRCm39) critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56,050,011 (GRCm39) missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56,005,189 (GRCm39) missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56,100,676 (GRCm39) missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 55,925,867 (GRCm39) missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56,047,000 (GRCm39) missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56,100,745 (GRCm39) missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56,072,932 (GRCm39) missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 55,925,125 (GRCm39) splice site probably null
R5031:Tbc1d32 UTSW 10 55,999,627 (GRCm39) missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56,071,500 (GRCm39) nonsense probably null
R5276:Tbc1d32 UTSW 10 56,027,914 (GRCm39) missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56,047,033 (GRCm39) missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 55,904,089 (GRCm39) missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 55,916,246 (GRCm39) missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56,071,571 (GRCm39) missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56,005,246 (GRCm39) missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56,026,973 (GRCm39) missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 55,964,489 (GRCm39) missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56,091,158 (GRCm39) missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 55,964,433 (GRCm39) missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56,038,304 (GRCm39) missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56,026,979 (GRCm39) missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56,071,525 (GRCm39) missense probably benign
R6422:Tbc1d32 UTSW 10 55,904,157 (GRCm39) nonsense probably null
R6508:Tbc1d32 UTSW 10 56,100,786 (GRCm39) missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56,056,626 (GRCm39) missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56,027,907 (GRCm39) nonsense probably null
R7012:Tbc1d32 UTSW 10 56,100,820 (GRCm39) missense probably damaging 0.99
R7288:Tbc1d32 UTSW 10 55,927,483 (GRCm39) critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56,027,929 (GRCm39) missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 55,904,173 (GRCm39) missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56,072,688 (GRCm39) missense possibly damaging 0.93
R8864:Tbc1d32 UTSW 10 55,963,655 (GRCm39) missense probably benign 0.01
R9018:Tbc1d32 UTSW 10 55,948,693 (GRCm39) missense probably benign 0.02
R9030:Tbc1d32 UTSW 10 56,037,241 (GRCm39) missense possibly damaging 0.92
R9530:Tbc1d32 UTSW 10 56,072,507 (GRCm39) missense probably damaging 0.98
R9616:Tbc1d32 UTSW 10 56,037,246 (GRCm39) missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56,046,977 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGTGGTACCCAAACCTTTTCTG -3'
(R):5'- TGGCTGCTCTACCCTTTAGTAG -3'

Sequencing Primer
(F):5'- CAGTATAGTAATTCCCCCACTGATG -3'
(R):5'- TGCTAATGTGTTGGAGAAATGAC -3'
Posted On 2019-06-26