Incidental Mutation 'R7253:Rgl2'
ID564107
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Nameral guanine nucleotide dissociation stimulator-like 2
SynonymsKE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7253 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33929543-33937687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33934990 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 457 (F457L)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
PDB Structure
STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047503
AA Change: F457L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: F457L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: F21L

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Meta Mutation Damage Score 0.8096 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Aldh1a2 A G 9: 71,215,934 T30A probably benign Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
B020004J07Rik A T 4: 101,835,528 V425E probably benign Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chd4 T A 6: 125,106,592 probably null Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dagla A T 19: 10,262,581 probably null Het
Dcaf7 C A 11: 106,047,843 probably null Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
E2f7 A G 10: 110,766,303 probably null Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Glyctk T C 9: 106,155,462 T451A probably damaging Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspbap1 G T 16: 35,817,230 C243F unknown Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mast3 C A 8: 70,789,682 probably null Het
Mier1 G A 4: 103,139,347 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Nlrx1 T A 9: 44,264,704 probably null Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pank4 A G 4: 154,970,920 N249S probably benign Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptpn13 G A 5: 103,565,284 E1758K possibly damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 unclassified probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 unclassified probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7984:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
X0028:Rgl2 UTSW 17 33932458 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTGTCAAGTGGAGCTG -3'
(R):5'- ATTCTTTCTGGAGGCGCAAC -3'

Sequencing Primer
(F):5'- GCTACACAGTGAGTCCCAGTCTC -3'
(R):5'- GGCGCAACAGCTCCGAAAG -3'
Posted On2019-06-26