Incidental Mutation 'R7254:Nif3l1'
ID 564114
Institutional Source Beutler Lab
Gene Symbol Nif3l1
Ensembl Gene ENSMUSG00000026036
Gene Name Ngg1 interacting factor 3-like 1 (S. pombe)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58445151-58481816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58450466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 171 (S171R)
Ref Sequence ENSEMBL: ENSMUSP00000084799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081677] [ENSMUST00000087521] [ENSMUST00000114337] [ENSMUST00000129759] [ENSMUST00000151272] [ENSMUST00000171597] [ENSMUST00000185990]
AlphaFold Q9EQ80
Predicted Effect probably benign
Transcript: ENSMUST00000081677
SMART Domains Protein: ENSMUSP00000080378
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 154 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087521
AA Change: S171R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000084799
Gene: ENSMUSG00000026036
AA Change: S171R

DomainStartEndE-ValueType
Pfam:NIF3 31 363 1.9e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114337
AA Change: S171R

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036
AA Change: S171R

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129759
SMART Domains Protein: ENSMUSP00000124713
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 154 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151272
SMART Domains Protein: ENSMUSP00000123553
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 131 3.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171597
AA Change: S171R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000127501
Gene: ENSMUSG00000026036
AA Change: S171R

DomainStartEndE-ValueType
Pfam:NIF3 31 363 2.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185990
SMART Domains Protein: ENSMUSP00000139979
Gene: ENSMUSG00000026035

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 90 1.1e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene is a member of the NGG1-interacting factor 3-like superfamily of transcriptional regulators and is ubiquitously expressed throughout embryonic development. The encoded protein interacts with a component of the constitutive photomorphogenesis 9 signalosome, and functions as a transcriptional corepressor of genes involved in neuronal differentiation. This gene is highly conserved from bacteria to human. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Nif3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nif3l1 APN 1 58455686 missense possibly damaging 0.56
IGL01657:Nif3l1 APN 1 58455612 missense probably damaging 0.98
IGL02159:Nif3l1 APN 1 58447946 splice site probably null
IGL02223:Nif3l1 APN 1 58448043 nonsense probably null
IGL02407:Nif3l1 APN 1 58457797 missense possibly damaging 0.87
IGL02435:Nif3l1 APN 1 58447861 missense possibly damaging 0.91
IGL02676:Nif3l1 APN 1 58455736 critical splice donor site probably null
IGL02721:Nif3l1 APN 1 58457849 missense probably damaging 1.00
R0472:Nif3l1 UTSW 1 58447828 missense probably damaging 1.00
R1036:Nif3l1 UTSW 1 58447873 missense probably damaging 1.00
R1256:Nif3l1 UTSW 1 58455649 missense probably damaging 0.99
R1439:Nif3l1 UTSW 1 58447943 missense probably damaging 1.00
R1483:Nif3l1 UTSW 1 58447726 missense probably benign 0.01
R2240:Nif3l1 UTSW 1 58452129 missense probably benign 0.35
R4379:Nif3l1 UTSW 1 58455579 intron probably benign
R4381:Nif3l1 UTSW 1 58455579 intron probably benign
R4552:Nif3l1 UTSW 1 58449324 unclassified probably benign
R6524:Nif3l1 UTSW 1 58457840 missense probably benign 0.01
R6567:Nif3l1 UTSW 1 58455630 missense probably benign 0.13
R6698:Nif3l1 UTSW 1 58450489 missense probably benign 0.01
R7841:Nif3l1 UTSW 1 58447883 missense probably damaging 1.00
R8358:Nif3l1 UTSW 1 58452129 missense probably benign 0.01
R8903:Nif3l1 UTSW 1 58447494 unclassified probably benign
R9057:Nif3l1 UTSW 1 58450489 missense probably benign 0.01
R9645:Nif3l1 UTSW 1 58447915 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTAAGGCGTATGTATGTATG -3'
(R):5'- GCAGGTAATAGCACGTGACTG -3'

Sequencing Primer
(F):5'- CATGAAAATGAGTTCTGAGACGTTTC -3'
(R):5'- AGGAGTAGTAGCTCACACCTGTTC -3'
Posted On 2019-06-26