Incidental Mutation 'R7254:Creb1'
ID 564116
Institutional Source Beutler Lab
Gene Symbol Creb1
Ensembl Gene ENSMUSG00000025958
Gene Name cAMP responsive element binding protein 1
Synonyms 3526402H21Rik, Creb-1, 2310001E10Rik, Creb
MMRRC Submission
Accession Numbers

Genbank: NM_009952.2, NM_133828.2, NM_001037726.1

Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 64532645-64604548 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 64576277 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 223 (Q223*)
Ref Sequence ENSEMBL: ENSMUSP00000132860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049932] [ENSMUST00000087366] [ENSMUST00000171164] [ENSMUST00000185594] [ENSMUST00000187811] [ENSMUST00000190348] [ENSMUST00000190876]
AlphaFold Q01147
Predicted Effect probably null
Transcript: ENSMUST00000049932
AA Change: Q277*
SMART Domains Protein: ENSMUSP00000059973
Gene: ENSMUSG00000025958
AA Change: Q277*

DomainStartEndE-ValueType
internal_repeat_1 16 89 5.16e-5 PROSPERO
Pfam:pKID 113 153 7.7e-24 PFAM
low complexity region 162 174 N/A INTRINSIC
internal_repeat_1 184 260 5.16e-5 PROSPERO
BRLZ 281 339 1.25e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087366
AA Change: Q263*
SMART Domains Protein: ENSMUSP00000084624
Gene: ENSMUSG00000025958
AA Change: Q263*

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171164
AA Change: Q223*
SMART Domains Protein: ENSMUSP00000132860
Gene: ENSMUSG00000025958
AA Change: Q223*

DomainStartEndE-ValueType
Pfam:pKID 59 101 9e-24 PFAM
low complexity region 108 120 N/A INTRINSIC
BRLZ 227 285 1.25e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185594
AA Change: Q263*
SMART Domains Protein: ENSMUSP00000139995
Gene: ENSMUSG00000025958
AA Change: Q263*

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187811
AA Change: Q263*
SMART Domains Protein: ENSMUSP00000140649
Gene: ENSMUSG00000025958
AA Change: Q263*

DomainStartEndE-ValueType
Pfam:pKID 99 141 3.8e-21 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190348
AA Change: Q277*
SMART Domains Protein: ENSMUSP00000140112
Gene: ENSMUSG00000025958
AA Change: Q277*

DomainStartEndE-ValueType
internal_repeat_1 16 89 5.16e-5 PROSPERO
Pfam:pKID 113 155 1.2e-23 PFAM
low complexity region 162 174 N/A INTRINSIC
internal_repeat_1 184 260 5.16e-5 PROSPERO
BRLZ 281 339 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190876
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for alleles lacking some or all isotypes exhibit a range of defects involving circadian rhythms, axonal growth, sensory neuron survival, long-term memory, fear conditioning, body size, respiration, and neonatal viability. [provided by MGI curators]
Allele List at MGI

All alleles(85) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(76)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Creb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Creb1 APN 1 64570125 splice site probably benign
IGL01991:Creb1 APN 1 64559754 missense probably benign
IGL03137:Creb1 APN 1 64576215 missense possibly damaging 0.95
IGL03408:Creb1 APN 1 64576332 splice site probably null
1mM(1):Creb1 UTSW 1 64574171 nonsense probably null
R0028:Creb1 UTSW 1 64570148 missense probably damaging 0.96
R0069:Creb1 UTSW 1 64576208 missense possibly damaging 0.91
R0069:Creb1 UTSW 1 64576208 missense possibly damaging 0.91
R0506:Creb1 UTSW 1 64570267 missense probably damaging 1.00
R1834:Creb1 UTSW 1 64550950 nonsense probably null
R1835:Creb1 UTSW 1 64550950 nonsense probably null
R1836:Creb1 UTSW 1 64550950 nonsense probably null
R7716:Creb1 UTSW 1 64566261 missense possibly damaging 0.94
R7934:Creb1 UTSW 1 64570213 missense probably benign 0.01
R8275:Creb1 UTSW 1 64558528 missense probably benign 0.20
R9005:Creb1 UTSW 1 64566319 critical splice donor site probably null
R9431:Creb1 UTSW 1 64576254 missense probably damaging 0.99
R9758:Creb1 UTSW 1 64559750 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATAGAGTCCCATTCCCTGTTTCC -3'
(R):5'- TAGCAAGATCCACTAATTCTACCAG -3'

Sequencing Primer
(F):5'- ATTCCCTGTTTCCCTTTTAATCTAAG -3'
(R):5'- TTCTACCAGAAAAAGAAAATCAATGC -3'
Posted On 2019-06-26