Incidental Mutation 'R7254:Serpinc1'
ID 564117
Institutional Source Beutler Lab
Gene Symbol Serpinc1
Ensembl Gene ENSMUSG00000026715
Gene Name serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
Synonyms At3, At-3, antithrombin, ATIII
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 160978585-161005863 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 160993618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 91 (C91S)
Ref Sequence ENSEMBL: ENSMUSP00000142122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064725] [ENSMUST00000191936] [ENSMUST00000194592] [ENSMUST00000195438] [ENSMUST00000195760]
AlphaFold P32261
Predicted Effect probably benign
Transcript: ENSMUST00000064725
SMART Domains Protein: ENSMUSP00000068971
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
SERPIN 93 462 5.55e-173 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191936
AA Change: C91S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142122
Gene: ENSMUSG00000026715
AA Change: C91S

DomainStartEndE-ValueType
Pfam:Serpin 1 91 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194455
Predicted Effect probably benign
Transcript: ENSMUST00000194592
SMART Domains Protein: ENSMUSP00000141556
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SERPIN 93 286 8.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195438
SMART Domains Protein: ENSMUSP00000141834
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
Pfam:Serpin 1 97 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195760
SMART Domains Protein: ENSMUSP00000141864
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Blast:SERPIN 32 107 5e-43 BLAST
PDB:2GD4|C 32 107 3e-43 PDB
SCOP:d1e05i_ 35 107 4e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit extensive subcutaneous hemorrhage, fibrin deposits in the myocardium and liver, and lethality by embryonic day 16.5. Heterozygotes challenged with lipopolysaccharide show increased fibrin deposits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Serpinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Serpinc1 APN 1 160993400 missense probably damaging 1.00
IGL01923:Serpinc1 APN 1 160989546 missense probably damaging 0.98
IGL01987:Serpinc1 APN 1 160993407 missense probably damaging 1.00
IGL02272:Serpinc1 APN 1 160999992 missense probably damaging 1.00
IGL02574:Serpinc1 APN 1 161002459 missense probably benign 0.00
IGL02730:Serpinc1 APN 1 161000028 missense probably damaging 0.97
IGL02861:Serpinc1 APN 1 160999991 missense probably damaging 0.99
IGL03377:Serpinc1 APN 1 160993442 missense probably damaging 1.00
R0277:Serpinc1 UTSW 1 160989702 start codon destroyed probably null 1.00
R1294:Serpinc1 UTSW 1 160989641 missense probably damaging 0.98
R1368:Serpinc1 UTSW 1 160993524 missense probably damaging 1.00
R1433:Serpinc1 UTSW 1 160993404 missense probably damaging 0.97
R1436:Serpinc1 UTSW 1 160993411 missense possibly damaging 0.63
R1480:Serpinc1 UTSW 1 160995319 missense probably benign 0.00
R1703:Serpinc1 UTSW 1 160993517 missense probably damaging 1.00
R1775:Serpinc1 UTSW 1 160989647 missense probably benign 0.07
R2007:Serpinc1 UTSW 1 160993540 missense probably benign 0.05
R3757:Serpinc1 UTSW 1 161002365 missense probably benign 0.00
R5134:Serpinc1 UTSW 1 160997570 splice site probably null
R5252:Serpinc1 UTSW 1 160989621 missense probably damaging 1.00
R7033:Serpinc1 UTSW 1 160997521 missense probably benign 0.04
R7262:Serpinc1 UTSW 1 160989659 missense probably damaging 1.00
R7429:Serpinc1 UTSW 1 160995441 missense probably benign 0.03
R8169:Serpinc1 UTSW 1 160993401 missense probably damaging 1.00
R8490:Serpinc1 UTSW 1 160989458 missense probably damaging 1.00
R9502:Serpinc1 UTSW 1 160993609 nonsense probably null
R9627:Serpinc1 UTSW 1 160993531 nonsense probably null
Z1176:Serpinc1 UTSW 1 160989456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATACCATCTCCGAGAAGAC -3'
(R):5'- CTTGTACAGTGTTTAAAGAGTAGCCTC -3'

Sequencing Primer
(F):5'- GATACCATCTCCGAGAAGACATCCG -3'
(R):5'- CTATATCTGAACGCTTGAGGACCG -3'
Posted On 2019-06-26