Incidental Mutation 'R7254:Ifi213'
ID 564119
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Name interferon activated gene 213
Synonyms E030037K03Rik, Pydc4, Pyr-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 173566283-173599274 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 173593963 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 120 (P120Q)
Ref Sequence ENSEMBL: ENSMUSP00000095070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097462] [ENSMUST00000150649] [ENSMUST00000180215]
AlphaFold D3Z5G0
Predicted Effect probably damaging
Transcript: ENSMUST00000097462
AA Change: P120Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095070
Gene: ENSMUSG00000073491
AA Change: P120Q

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150649
AA Change: P120Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491
AA Change: P120Q

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180215
AA Change: P120Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136238
Gene: ENSMUSG00000073491
AA Change: P120Q

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173594053 splice site probably benign
IGL00908:Ifi213 APN 1 173595083 missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173593952 missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173595032 missense possibly damaging 0.91
R0709:Ifi213 UTSW 1 173589800 missense possibly damaging 0.70
R1518:Ifi213 UTSW 1 173589663 missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R1822:Ifi213 UTSW 1 173589842 missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173589600 missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173568808 critical splice donor site probably null
R2108:Ifi213 UTSW 1 173569102 critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173590024 missense probably benign
R3890:Ifi213 UTSW 1 173567256 missense probably benign 0.33
R4544:Ifi213 UTSW 1 173582127 splice site probably null
R4611:Ifi213 UTSW 1 173589914 missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173590420 missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173567172 utr 3 prime probably benign
R5126:Ifi213 UTSW 1 173590015 missense possibly damaging 0.85
R5472:Ifi213 UTSW 1 173567272 splice site probably null
R5625:Ifi213 UTSW 1 173569063 missense possibly damaging 0.73
R5789:Ifi213 UTSW 1 173568794 splice site probably benign
R5898:Ifi213 UTSW 1 173568979 missense probably benign 0.01
R6025:Ifi213 UTSW 1 173595234 missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173594015 missense probably benign 0.18
R6348:Ifi213 UTSW 1 173590282 missense possibly damaging 0.46
R6564:Ifi213 UTSW 1 173595296 start codon destroyed probably null 0.06
R7292:Ifi213 UTSW 1 173595125 missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R7901:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R8100:Ifi213 UTSW 1 173595182 missense probably damaging 1.00
R8352:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R8425:Ifi213 UTSW 1 173589860 missense probably benign
R8452:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R9357:Ifi213 UTSW 1 173568826 missense probably benign 0.01
RF010:Ifi213 UTSW 1 173582153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAAATGTTCTCAAAAGGAAGA -3'
(R):5'- CTGAGACATAAGCAGGAGGC -3'

Sequencing Primer
(F):5'- CTCCAGGTTCAGAGAGAGACTGTATC -3'
(R):5'- GCAAATGCATAAAATGGACTTCAGC -3'
Posted On 2019-06-26