Incidental Mutation 'R7254:Hoxd9'
ID 564121
Institutional Source Beutler Lab
Gene Symbol Hoxd9
Ensembl Gene ENSMUSG00000043342
Gene Name homeobox D9
Synonyms Hox-5.2, Hox-4.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7254 (G1)
Quality Score 221.009
Status Validated
Chromosome 2
Chromosomal Location 74697727-74700208 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74698374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 107 (W107R)
Ref Sequence ENSEMBL: ENSMUSP00000058490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059272] [ENSMUST00000061745]
AlphaFold P28357
Predicted Effect probably damaging
Transcript: ENSMUST00000059272
AA Change: W107R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058490
Gene: ENSMUSG00000043342
AA Change: W107R

DomainStartEndE-ValueType
Pfam:Hox9_act 1 126 2e-47 PFAM
low complexity region 155 176 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
low complexity region 248 256 N/A INTRINSIC
HOX 272 334 6.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061745
SMART Domains Protein: ENSMUSP00000062412
Gene: ENSMUSG00000050368

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
HOX 266 328 3.3e-27 SMART
Meta Mutation Damage Score 0.8112 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit anterior transformation of lumbar, sacral, and caudal vertebrae with abnormal humerus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Hoxd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0723:Hoxd9 UTSW 2 74698828 missense probably damaging 1.00
R3743:Hoxd9 UTSW 2 74698366 missense probably damaging 0.99
R4155:Hoxd9 UTSW 2 74699323 missense probably benign 0.15
R4261:Hoxd9 UTSW 2 74695687 unclassified probably benign
R5794:Hoxd9 UTSW 2 74699273 missense probably damaging 1.00
R6114:Hoxd9 UTSW 2 74699365 missense probably damaging 1.00
R6197:Hoxd9 UTSW 2 74698822 missense probably damaging 0.99
R6248:Hoxd9 UTSW 2 74698636 missense probably benign 0.09
R6268:Hoxd9 UTSW 2 74698089 missense probably damaging 1.00
R6717:Hoxd9 UTSW 2 74698389 missense probably benign 0.01
R6809:Hoxd9 UTSW 2 74699246 missense probably damaging 1.00
R7183:Hoxd9 UTSW 2 74698365 missense possibly damaging 0.59
R9160:Hoxd9 UTSW 2 74699417 missense unknown
R9277:Hoxd9 UTSW 2 74699195 missense possibly damaging 0.76
R9445:Hoxd9 UTSW 2 74698071 missense probably damaging 0.99
Z1176:Hoxd9 UTSW 2 74698128 missense probably damaging 0.99
Z1177:Hoxd9 UTSW 2 74698525 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACGTGGACTCGCTCATAGG -3'
(R):5'- CGAGTTGCACGGGAATTCTG -3'

Sequencing Primer
(F):5'- GACTCGCTCATAGGCCATG -3'
(R):5'- CGGAGCACTCAGTCCTTTTGG -3'
Posted On 2019-06-26