Incidental Mutation 'R7254:Kcnab1'
ID 564124
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Name potassium voltage-gated channel, shaker-related subfamily, beta member 1
Synonyms mKv(beta)1, Akr8a8, Kvbeta1.1
MMRRC Submission 045315-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 64856636-65285643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65226908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 196 (S196G)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049230]
AlphaFold P63143
Predicted Effect probably benign
Transcript: ENSMUST00000049230
AA Change: S196G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: S196G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Meta Mutation Damage Score 0.1114 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A T 7: 43,147,623 (GRCm39) D249E probably damaging Het
Acacb A C 5: 114,347,812 (GRCm39) probably null Het
Adnp A G 2: 168,025,918 (GRCm39) V459A probably damaging Het
Arid3b T C 9: 57,704,037 (GRCm39) K304E probably damaging Het
Ash1l G T 3: 88,977,816 (GRCm39) R2713L probably damaging Het
Bmpr1a A C 14: 34,136,720 (GRCm39) D490E probably benign Het
Cacna1g A T 11: 94,323,393 (GRCm39) C1270* probably null Het
Cep295nl G T 11: 118,223,866 (GRCm39) P326Q probably damaging Het
Cfap100 T C 6: 90,383,043 (GRCm39) I377V unknown Het
Creb1 C T 1: 64,615,436 (GRCm39) Q223* probably null Het
Ctsc G A 7: 87,958,767 (GRCm39) G349D probably damaging Het
Ddx41 G A 13: 55,681,769 (GRCm39) R311* probably null Het
Dpcd A G 19: 45,565,473 (GRCm39) Q149R probably benign Het
Dse T A 10: 34,060,144 (GRCm39) probably benign Het
Dync2i1 A G 12: 116,226,205 (GRCm39) probably benign Het
Eef2k C T 7: 120,488,488 (GRCm39) H458Y probably benign Het
Gipr A T 7: 18,897,538 (GRCm39) V90E probably damaging Het
Gm14412 A T 2: 177,009,189 (GRCm39) D22E probably damaging Het
Gm21886 A T 18: 80,132,950 (GRCm39) C69* probably null Het
Gm5114 G A 7: 39,058,390 (GRCm39) L410F probably benign Het
Gmip T A 8: 70,269,118 (GRCm39) probably null Het
Gtf2f1 T C 17: 57,314,101 (GRCm39) T128A possibly damaging Het
Hnrnpr A G 4: 136,059,886 (GRCm39) E330G possibly damaging Het
Hoxd9 T A 2: 74,528,718 (GRCm39) W107R probably damaging Het
Iars1 T C 13: 49,876,554 (GRCm39) probably null Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Ifi213 G T 1: 173,421,529 (GRCm39) P120Q probably damaging Het
Il6 A T 5: 30,219,906 (GRCm39) Q94L probably benign Het
Kcnv1 C T 15: 44,976,604 (GRCm39) V228I probably benign Het
Lars2 A G 9: 123,284,028 (GRCm39) T739A possibly damaging Het
Med13 T C 11: 86,210,661 (GRCm39) S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,660,931 (GRCm39) probably null Het
Myh9 T G 15: 77,650,024 (GRCm39) Q1646P probably damaging Het
Nif3l1 T A 1: 58,489,625 (GRCm39) S171R probably benign Het
Or13n4 A G 7: 106,422,777 (GRCm39) *319Q probably null Het
Or1e1c A G 11: 73,266,201 (GRCm39) I212V probably benign Het
Or1r1 A G 11: 73,874,603 (GRCm39) V277A probably benign Het
Or51f23 A G 7: 102,452,765 (GRCm39) T27A probably benign Het
Or5b113 A T 19: 13,342,475 (GRCm39) D161V probably benign Het
Or6c5b T C 10: 129,245,649 (GRCm39) V138A probably benign Het
Or8c8 T C 9: 38,164,719 (GRCm39) M2T probably benign Het
Pak5 A T 2: 135,958,684 (GRCm39) S135T possibly damaging Het
Prr29 A T 11: 106,265,684 (GRCm39) M1L probably damaging Het
Ptpn13 T A 5: 103,742,502 (GRCm39) V2407E probably damaging Het
Ralgapa1 T A 12: 55,741,978 (GRCm39) H1310L probably damaging Het
Raph1 T C 1: 60,538,767 (GRCm39) S393G unknown Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ror2 A G 13: 53,272,756 (GRCm39) I303T possibly damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn10a C T 9: 119,447,921 (GRCm39) D1378N probably damaging Het
Serpinc1 T A 1: 160,821,188 (GRCm39) C91S probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spata31d1e T C 13: 59,889,790 (GRCm39) I677V probably benign Het
Tada1 T A 1: 166,216,217 (GRCm39) C139* probably null Het
Tbr1 T A 2: 61,636,386 (GRCm39) V254E probably damaging Het
Timd4 A T 11: 46,734,016 (GRCm39) I340F probably benign Het
Tubb2a T C 13: 34,258,515 (GRCm39) Y425C probably damaging Het
Zfp292 A T 4: 34,819,476 (GRCm39) M287K probably damaging Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65,226,875 (GRCm39) missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65,265,695 (GRCm39) missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65,264,503 (GRCm39) missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65,209,600 (GRCm39) missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65,265,741 (GRCm39) missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0811:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R0812:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65,209,615 (GRCm39) critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65,283,933 (GRCm39) missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65,272,060 (GRCm39) missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65,017,368 (GRCm39) missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65,264,435 (GRCm39) splice site probably benign
R3916:Kcnab1 UTSW 3 65,211,585 (GRCm39) critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65,207,035 (GRCm39) missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65,204,896 (GRCm39) intron probably benign
R4796:Kcnab1 UTSW 3 65,211,586 (GRCm39) critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65,283,976 (GRCm39) missense possibly damaging 0.59
R7347:Kcnab1 UTSW 3 65,283,952 (GRCm39) missense probably benign 0.07
R7424:Kcnab1 UTSW 3 65,173,924 (GRCm39) missense possibly damaging 0.80
Z1177:Kcnab1 UTSW 3 65,264,554 (GRCm39) missense probably benign 0.08
Z1177:Kcnab1 UTSW 3 65,173,931 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCTGTTCAAGAGGACTC -3'
(R):5'- CTTTTGGGGTCAATACAGAAGC -3'

Sequencing Primer
(F):5'- GAGGACTCTTGTAATTAACTCAGTG -3'
(R):5'- TTTTGGGGTCAATACAGAAGCTAAAG -3'
Posted On 2019-06-26