Incidental Mutation 'R7254:Il6'
ID 564128
Institutional Source Beutler Lab
Gene Symbol Il6
Ensembl Gene ENSMUSG00000025746
Gene Name interleukin 6
Synonyms Il-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 30013114-30019981 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30014908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 94 (Q94L)
Ref Sequence ENSEMBL: ENSMUSP00000026845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026845] [ENSMUST00000195978] [ENSMUST00000199183] [ENSMUST00000199765]
AlphaFold P08505
PDB Structure Solution structure of mouse IL-6 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000026845
AA Change: Q94L

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026845
Gene: ENSMUSG00000025746
AA Change: Q94L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 209 2.1e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195978
AA Change: Q94L

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143544
Gene: ENSMUSG00000025746
AA Change: Q94L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 162 5.8e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199183
AA Change: Q94L

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143293
Gene: ENSMUSG00000025746
AA Change: Q94L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 175 3.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199765
AA Change: Q77L

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143157
Gene: ENSMUSG00000025746
AA Change: Q77L

DomainStartEndE-ValueType
IL6 38 192 2.1e-98 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show impaired immune response to pathogens, decreased T cell numbers and resistance to plasma cell neoplasia. They are defective in wound healing and liver regeneration and show increased emotionality and high bone turnover rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Il6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Il6 APN 5 30014841 missense probably benign 0.06
IGL01085:Il6 APN 5 30013489 missense probably damaging 0.98
IGL01549:Il6 APN 5 30019471 missense probably benign 0.01
R1510:Il6 UTSW 5 30018062 missense probably damaging 0.96
R1721:Il6 UTSW 5 30013492 missense possibly damaging 0.90
R1774:Il6 UTSW 5 30019435 missense probably benign
R2018:Il6 UTSW 5 30014947 critical splice donor site probably null
R2153:Il6 UTSW 5 30013504 nonsense probably null
R2344:Il6 UTSW 5 30014856 missense probably benign 0.00
R3889:Il6 UTSW 5 30018068 missense possibly damaging 0.57
R4743:Il6 UTSW 5 30018044 missense probably damaging 0.96
R4769:Il6 UTSW 5 30018078 nonsense probably null
R4965:Il6 UTSW 5 30013493 missense possibly damaging 0.53
R5024:Il6 UTSW 5 30019514 missense probably damaging 1.00
R5817:Il6 UTSW 5 30018008 missense probably benign
R5858:Il6 UTSW 5 30013474 missense possibly damaging 0.67
R6886:Il6 UTSW 5 30018203 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTCCTGGCTATGAAAGAG -3'
(R):5'- GGTTGGTAAACTTTCCCTCACC -3'

Sequencing Primer
(F):5'- TATGAAAGAGCATGACTTGGCCCTC -3'
(R):5'- GTATTCAAGCTACTGCAGGCC -3'
Posted On 2019-06-26