Incidental Mutation 'R0581:Dpp4'
ID56413
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0581 (G1)
Quality Score210
Status Validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62356676 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 497 (M497L)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably benign
Transcript: ENSMUST00000047812
AA Change: M497L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: M497L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136879
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Ccer2 T A 7: 28,757,026 probably benign Het
Cyp2c54 T A 19: 40,047,555 T304S probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Lats1 A G 10: 7,702,941 T610A possibly damaging Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Myh7 T C 14: 54,985,496 I751V probably benign Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Npr3 T A 15: 11,851,450 D418V probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Ralgapb A G 2: 158,492,961 T1043A probably benign Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R3765:Dpp4 UTSW 2 62386436 missense probably benign 0.17
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5173:Dpp4 UTSW 2 62387130 missense probably damaging 1.00
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7366:Dpp4 UTSW 2 62354599 missense probably damaging 1.00
R7413:Dpp4 UTSW 2 62356989 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8004:Dpp4 UTSW 2 62358828 missense probably benign 0.00
R8197:Dpp4 UTSW 2 62372827 missense probably benign 0.31
R8341:Dpp4 UTSW 2 62347890 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCTACTGTCCTTAGTGGTGCCTG -3'
(R):5'- AGAGAGCTGAGCTTCTTACCTCCTG -3'

Sequencing Primer
(F):5'- TGAGAGCGATCCATGCTTAC -3'
(R):5'- TTGGCATTAGAGACTTACCCAGG -3'
Posted On2013-07-11