Incidental Mutation 'R7254:Cfap100'
ID 564131
Institutional Source Beutler Lab
Gene Symbol Cfap100
Ensembl Gene ENSMUSG00000048794
Gene Name cilia and flagella associated protein 100
Synonyms C030041G11Rik, C230069K22Rik, Ccdc37
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 90403479-90428797 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90406061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 377 (I377V)
Ref Sequence ENSEMBL: ENSMUSP00000059976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062750] [ENSMUST00000075117] [ENSMUST00000153843] [ENSMUST00000165673]
AlphaFold Q80VN0
Predicted Effect unknown
Transcript: ENSMUST00000062750
AA Change: I377V
SMART Domains Protein: ENSMUSP00000059976
Gene: ENSMUSG00000048794
AA Change: I377V

DomainStartEndE-ValueType
Pfam:DUF4200 1 127 5.4e-26 PFAM
coiled coil region 242 282 N/A INTRINSIC
low complexity region 289 309 N/A INTRINSIC
coiled coil region 374 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075117
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153843
Predicted Effect unknown
Transcript: ENSMUST00000165673
AA Change: I531V
SMART Domains Protein: ENSMUSP00000126515
Gene: ENSMUSG00000048794
AA Change: I531V

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
Pfam:DUF4200 154 272 1.2e-35 PFAM
coiled coil region 396 436 N/A INTRINSIC
low complexity region 443 463 N/A INTRINSIC
coiled coil region 528 581 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Cfap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Cfap100 APN 6 90415805 missense probably benign 0.36
IGL01067:Cfap100 APN 6 90406114 missense probably damaging 1.00
IGL01347:Cfap100 APN 6 90406121 missense possibly damaging 0.65
IGL01803:Cfap100 APN 6 90415735 missense probably benign 0.29
IGL01910:Cfap100 APN 6 90409624 missense probably damaging 0.99
IGL02086:Cfap100 APN 6 90413972 missense probably damaging 1.00
IGL02680:Cfap100 APN 6 90412235 missense probably benign 0.03
IGL03046:Cfap100 APN 6 90412350 splice site probably null
R0391:Cfap100 UTSW 6 90405339 splice site probably benign
R0883:Cfap100 UTSW 6 90415906 splice site probably benign
R1022:Cfap100 UTSW 6 90413004 missense possibly damaging 0.50
R1024:Cfap100 UTSW 6 90413004 missense possibly damaging 0.50
R1086:Cfap100 UTSW 6 90403908 nonsense probably null
R1440:Cfap100 UTSW 6 90412184 missense probably benign 0.06
R1914:Cfap100 UTSW 6 90412347 splice site probably benign
R1915:Cfap100 UTSW 6 90412347 splice site probably benign
R2257:Cfap100 UTSW 6 90413820 missense possibly damaging 0.83
R4370:Cfap100 UTSW 6 90413394 missense probably damaging 1.00
R4739:Cfap100 UTSW 6 90412843 critical splice donor site probably null
R4895:Cfap100 UTSW 6 90406102 missense possibly damaging 0.95
R5160:Cfap100 UTSW 6 90413710 critical splice donor site probably null
R5983:Cfap100 UTSW 6 90419391 intron probably benign
R6164:Cfap100 UTSW 6 90415786 missense probably benign 0.15
R6394:Cfap100 UTSW 6 90417623 missense possibly damaging 0.58
R6658:Cfap100 UTSW 6 90413418 missense probably damaging 0.99
R7094:Cfap100 UTSW 6 90413454 missense
R7922:Cfap100 UTSW 6 90403980 missense unknown
R7983:Cfap100 UTSW 6 90415705 missense
R8169:Cfap100 UTSW 6 90417674 missense
R8490:Cfap100 UTSW 6 90413739 utr 3 prime probably benign
R8835:Cfap100 UTSW 6 90409615 missense
R9080:Cfap100 UTSW 6 90406201 missense unknown
R9124:Cfap100 UTSW 6 90409348 missense
R9185:Cfap100 UTSW 6 90413434 missense
R9663:Cfap100 UTSW 6 90409346 missense
Z1176:Cfap100 UTSW 6 90406150 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGATGTCCAGGTAGAGAGCTTC -3'
(R):5'- ACACTACTGATTGTCCCCAGG -3'

Sequencing Primer
(F):5'- TAGAGAGCTTCTACCCTGTGGC -3'
(R):5'- TCCCCAGGACACGATGTTG -3'
Posted On 2019-06-26