Incidental Mutation 'R7254:4931406B18Rik'
ID 564135
Institutional Source Beutler Lab
Gene Symbol 4931406B18Rik
Ensembl Gene ENSMUSG00000013353
Gene Name RIKEN cDNA 4931406B18 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43492044-43505940 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43498199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 249 (D249E)
Ref Sequence ENSEMBL: ENSMUSP00000013497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013497] [ENSMUST00000163474] [ENSMUST00000163619] [ENSMUST00000168213] [ENSMUST00000168883] [ENSMUST00000171174] [ENSMUST00000191516]
AlphaFold A2RSL7
Predicted Effect probably damaging
Transcript: ENSMUST00000013497
AA Change: D249E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013497
Gene: ENSMUSG00000013353
AA Change: D249E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2ZG3|A 24 185 9e-7 PDB
Blast:IG_like 119 185 3e-19 BLAST
low complexity region 186 205 N/A INTRINSIC
SCOP:d1iray3 219 297 6e-3 SMART
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163474
AA Change: D155E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126619
Gene: ENSMUSG00000013353
AA Change: D155E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 111 3e-12 BLAST
SCOP:d1he7a_ 111 203 1e-3 SMART
Blast:IG_like 125 194 1e-5 BLAST
transmembrane domain 217 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163619
SMART Domains Protein: ENSMUSP00000131071
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:2ZG3|A 17 88 1e-5 PDB
Blast:IG_like 22 88 2e-21 BLAST
low complexity region 89 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168213
SMART Domains Protein: ENSMUSP00000129928
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 119 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168883
Predicted Effect probably damaging
Transcript: ENSMUST00000171174
AA Change: D249E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129888
Gene: ENSMUSG00000013353
AA Change: D249E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191516
AA Change: D249E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139468
Gene: ENSMUSG00000013353
AA Change: D249E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in 4931406B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:4931406B18Rik APN 7 43504175 splice site probably benign
IGL01902:4931406B18Rik APN 7 43497843 missense probably damaging 0.96
IGL02616:4931406B18Rik APN 7 43501013 splice site probably null
IGL02677:4931406B18Rik APN 7 43501095 nonsense probably null
IGL03030:4931406B18Rik APN 7 43495633 missense possibly damaging 0.62
R0007:4931406B18Rik UTSW 7 43498042 splice site probably benign
R0788:4931406B18Rik UTSW 7 43499199 missense probably damaging 0.98
R1544:4931406B18Rik UTSW 7 43498119 missense possibly damaging 0.92
R2995:4931406B18Rik UTSW 7 43499368 missense probably damaging 1.00
R4656:4931406B18Rik UTSW 7 43501141 missense probably benign 0.20
R5595:4931406B18Rik UTSW 7 43497872 missense possibly damaging 0.92
R6288:4931406B18Rik UTSW 7 43498125 missense probably damaging 1.00
R6389:4931406B18Rik UTSW 7 43497830 missense possibly damaging 0.94
R6651:4931406B18Rik UTSW 7 43498072 missense possibly damaging 0.81
R6912:4931406B18Rik UTSW 7 43501147 missense possibly damaging 0.95
R7615:4931406B18Rik UTSW 7 43497849 missense possibly damaging 0.64
R8167:4931406B18Rik UTSW 7 43497864 missense possibly damaging 0.79
R9052:4931406B18Rik UTSW 7 43498207 nonsense probably null
R9109:4931406B18Rik UTSW 7 43499278 missense
R9182:4931406B18Rik UTSW 7 43504216 missense probably damaging 0.97
R9201:4931406B18Rik UTSW 7 43501285 missense possibly damaging 0.46
R9787:4931406B18Rik UTSW 7 43501271 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATGTTTGTGCTCATCCTGGC -3'
(R):5'- TGAGTGAACGTGTGGATCTC -3'

Sequencing Primer
(F):5'- AGTGCTGGCCTTCCACC -3'
(R):5'- AGTGAACGTGTGGATCTCTCTCTC -3'
Posted On 2019-06-26