Mutagenetix > Incidental Mutation

Incidental Mutation 'R7254:Ctsc'

564136

Institutional Source

Beutler Lab

Gene Symbol

Ctsc

Ensembl Gene

ENSMUSG00000030560

Gene Name

cathepsin C

Synonyms

DPPI, dipeptidylpeptidase 1, DPP1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R7254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88278085-88310888 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88309559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 349 (G349D)

Ref Sequence

ENSEMBL: ENSMUSP00000032779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032779] [ENSMUST00000128791]

AlphaFold

P97821

Predicted Effect

probably damaging
Transcript: ENSMUST00000032779
AA Change: G349D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032779
Gene: ENSMUSG00000030560
AA Change: G349D

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:CathepsinC_exc	25	141	1.5e-48	PFAM
Pept_C1	230	457	1.05e-79	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128791

SMART Domains

Protein: ENSMUSP00000119503
Gene: ENSMUSG00000030560

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:CathepsinC_exc	25	141	7.1e-62	PFAM
SCOP:d3gcb__	144	254	4e-8	SMART
Blast:Pept_C1	229	254	4e-9	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the dipeptidyl peptidase 1 light, heavy, and exclusion domain chains, which together comprise one subunit of the homotetrameric enzyme. This enzyme has amino dipeptidase activity and may play a role in the activation of granzymes during inflammation. Homozygous knockout mice for this gene exhibit impaired granzyme activation and enhanced survival in a sepsis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit cytotoxic lymphocytes with inactive granzymes A and B which are incapable of granule-mediated apoptosis. Mutant mast cells lack activated chymase activity. Homozygotes for other alleles display a scruffy coat with age and behavioral abnormalities [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,741,976	I677V	probably benign	Het
4931406B18Rik	A	T	7: 43,498,199	D249E	probably damaging	Het
Acacb	A	C	5: 114,209,751		probably null	Het
Adnp	A	G	2: 168,183,998	V459A	probably damaging	Het
Arid3b	T	C	9: 57,796,754	K304E	probably damaging	Het
Ash1l	G	T	3: 89,070,509	R2713L	probably damaging	Het
Bmpr1a	A	C	14: 34,414,763	D490E	probably benign	Het
Cacna1g	A	T	11: 94,432,567	C1270*	probably null	Het
Cep295nl	G	T	11: 118,333,040	P326Q	probably damaging	Het
Cfap100	T	C	6: 90,406,061	I377V	unknown	Het
Creb1	C	T	1: 64,576,277	Q223*	probably null	Het
Ddx41	G	A	13: 55,533,956	R311*	probably null	Het
Dse	T	A	10: 34,184,148		probably benign	Het
Eef2k	C	T	7: 120,889,265	H458Y	probably benign	Het
Gipr	A	T	7: 19,163,613	V90E	probably damaging	Het
Gm14412	A	T	2: 177,317,396	D22E	probably damaging	Het
Gm17018	A	G	19: 45,577,034	Q149R	probably benign	Het
Gm21886	A	T	18: 80,089,735	C69*	probably null	Het
Gm5114	G	A	7: 39,408,966	L410F	probably benign	Het
Gmip	T	A	8: 69,816,468		probably null	Het
Gtf2f1	T	C	17: 57,007,101	T128A	possibly damaging	Het
Hnrnpr	A	G	4: 136,332,575	E330G	possibly damaging	Het
Hoxd9	T	A	2: 74,698,374	W107R	probably damaging	Het
Iars	T	C	13: 49,723,078		probably null	Het
Idh2	TCCCAGGGCC	TCC	7: 80,098,331		probably null	Het
Ifi213	G	T	1: 173,593,963	P120Q	probably damaging	Het
Il6	A	T	5: 30,014,908	Q94L	probably benign	Het
Kcnab1	A	G	3: 65,319,487	S196G	probably benign	Het
Kcnv1	C	T	15: 45,113,208	V228I	probably benign	Het
Lars2	A	G	9: 123,454,963	T739A	possibly damaging	Het
Med13	T	C	11: 86,319,835	S494G	probably benign	Het
Mtrf1	GCCTTC	GC	14: 79,423,491		probably null	Het
Myh9	T	G	15: 77,765,824	Q1646P	probably damaging	Het
Nif3l1	T	A	1: 58,450,466	S171R	probably benign	Het
Olfr143	T	C	9: 38,253,423	M2T	probably benign	Het
Olfr1467	A	T	19: 13,365,111	D161V	probably benign	Het
Olfr376	A	G	11: 73,375,375	I212V	probably benign	Het
Olfr398	A	G	11: 73,983,777	V277A	probably benign	Het
Olfr564	A	G	7: 102,803,558	T27A	probably benign	Het
Olfr702	A	G	7: 106,823,570	*319Q	probably null	Het
Olfr785	T	C	10: 129,409,780	V138A	probably benign	Het
Pak7	A	T	2: 136,116,764	S135T	possibly damaging	Het
Prr29	A	T	11: 106,374,858	M1L	probably damaging	Het
Ptpn13	T	A	5: 103,594,636	V2407E	probably damaging	Het
Ralgapa1	T	A	12: 55,695,193	H1310L	probably damaging	Het
Raph1	T	C	1: 60,499,608	S393G	unknown	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Ror2	A	G	13: 53,118,720	I303T	possibly damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn10a	C	T	9: 119,618,855	D1378N	probably damaging	Het
Serpinc1	T	A	1: 160,993,618	C91S	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tada1	T	A	1: 166,388,648	C139*	probably null	Het
Tbr1	T	A	2: 61,806,042	V254E	probably damaging	Het
Timd4	A	T	11: 46,843,189	I340F	probably benign	Het
Tubb2a	T	C	13: 34,074,532	Y425C	probably damaging	Het
Wdr60	A	G	12: 116,262,585		probably benign	Het
Zfp292	A	T	4: 34,819,476	M287K	probably damaging	Het

Other mutations in Ctsc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01147:Ctsc	APN	7	88302271	missense	possibly damaging	0.78
IGL02709:Ctsc	APN	7	88308139	missense	probably damaging	0.99
IGL03103:Ctsc	APN	7	88309805	missense	probably benign
IGL03117:Ctsc	APN	7	88309780	missense	probably damaging	0.99
R0071:Ctsc	UTSW	7	88308149	unclassified	probably benign
R0334:Ctsc	UTSW	7	88278342	missense	possibly damaging	0.81
R0587:Ctsc	UTSW	7	88297229	missense	probably benign	0.35
R1006:Ctsc	UTSW	7	88309829	missense	probably damaging	1.00
R1401:Ctsc	UTSW	7	88281498	missense	probably damaging	1.00
R1472:Ctsc	UTSW	7	88281462	missense	possibly damaging	0.88
R1602:Ctsc	UTSW	7	88278304	missense	possibly damaging	0.77
R1650:Ctsc	UTSW	7	88281426	nonsense	probably null
R1656:Ctsc	UTSW	7	88281408	missense	possibly damaging	0.64
R1808:Ctsc	UTSW	7	88299542	missense	possibly damaging	0.49
R3848:Ctsc	UTSW	7	88309610	missense	probably benign	0.01
R4154:Ctsc	UTSW	7	88299547	missense	probably benign	0.01
R4614:Ctsc	UTSW	7	88278375	critical splice donor site	probably null
R5313:Ctsc	UTSW	7	88309553	missense	probably damaging	1.00
R6863:Ctsc	UTSW	7	88302278	nonsense	probably null
R6949:Ctsc	UTSW	7	88281458	missense	probably damaging	1.00
R7220:Ctsc	UTSW	7	88297153	missense	probably damaging	1.00
R7244:Ctsc	UTSW	7	88302222	missense	probably benign
R7732:Ctsc	UTSW	7	88297159	missense	probably damaging	0.98
R8157:Ctsc	UTSW	7	88302208	missense	probably benign	0.01
R8331:Ctsc	UTSW	7	88297120	missense	possibly damaging	0.53
R8392:Ctsc	UTSW	7	88297243	missense	probably benign	0.00
R8971:Ctsc	UTSW	7	88309816	missense	probably benign	0.00
R9005:Ctsc	UTSW	7	88278294	missense	probably damaging	1.00
R9113:Ctsc	UTSW	7	88309896	missense	possibly damaging	0.93
R9131:Ctsc	UTSW	7	88309808	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGAGTATAGAAGTTGTGCCTG -3'
(R):5'- CAGCATGATTTGTCAGCTCG -3'

Sequencing Primer
(F):5'- ATAGAAGTTGTGCCTGCCTTC -3'
(R):5'- CATGATTTGTCAGCTCGAAGGG -3'

Posted On

2019-06-26