Incidental Mutation 'R7254:Ctsc'
ID 564136
Institutional Source Beutler Lab
Gene Symbol Ctsc
Ensembl Gene ENSMUSG00000030560
Gene Name cathepsin C
Synonyms DPPI, dipeptidylpeptidase 1, DPP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 88278085-88310888 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88309559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 349 (G349D)
Ref Sequence ENSEMBL: ENSMUSP00000032779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032779] [ENSMUST00000128791]
AlphaFold P97821
Predicted Effect probably damaging
Transcript: ENSMUST00000032779
AA Change: G349D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032779
Gene: ENSMUSG00000030560
AA Change: G349D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 1.5e-48 PFAM
Pept_C1 230 457 1.05e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128791
SMART Domains Protein: ENSMUSP00000119503
Gene: ENSMUSG00000030560

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 7.1e-62 PFAM
SCOP:d3gcb__ 144 254 4e-8 SMART
Blast:Pept_C1 229 254 4e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the dipeptidyl peptidase 1 light, heavy, and exclusion domain chains, which together comprise one subunit of the homotetrameric enzyme. This enzyme has amino dipeptidase activity and may play a role in the activation of granzymes during inflammation. Homozygous knockout mice for this gene exhibit impaired granzyme activation and enhanced survival in a sepsis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit cytotoxic lymphocytes with inactive granzymes A and B which are incapable of granule-mediated apoptosis. Mutant mast cells lack activated chymase activity. Homozygotes for other alleles display a scruffy coat with age and behavioral abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Ctsc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Ctsc APN 7 88302271 missense possibly damaging 0.78
IGL02709:Ctsc APN 7 88308139 missense probably damaging 0.99
IGL03103:Ctsc APN 7 88309805 missense probably benign
IGL03117:Ctsc APN 7 88309780 missense probably damaging 0.99
R0071:Ctsc UTSW 7 88308149 unclassified probably benign
R0334:Ctsc UTSW 7 88278342 missense possibly damaging 0.81
R0587:Ctsc UTSW 7 88297229 missense probably benign 0.35
R1006:Ctsc UTSW 7 88309829 missense probably damaging 1.00
R1401:Ctsc UTSW 7 88281498 missense probably damaging 1.00
R1472:Ctsc UTSW 7 88281462 missense possibly damaging 0.88
R1602:Ctsc UTSW 7 88278304 missense possibly damaging 0.77
R1650:Ctsc UTSW 7 88281426 nonsense probably null
R1656:Ctsc UTSW 7 88281408 missense possibly damaging 0.64
R1808:Ctsc UTSW 7 88299542 missense possibly damaging 0.49
R3848:Ctsc UTSW 7 88309610 missense probably benign 0.01
R4154:Ctsc UTSW 7 88299547 missense probably benign 0.01
R4614:Ctsc UTSW 7 88278375 critical splice donor site probably null
R5313:Ctsc UTSW 7 88309553 missense probably damaging 1.00
R6863:Ctsc UTSW 7 88302278 nonsense probably null
R6949:Ctsc UTSW 7 88281458 missense probably damaging 1.00
R7220:Ctsc UTSW 7 88297153 missense probably damaging 1.00
R7244:Ctsc UTSW 7 88302222 missense probably benign
R7732:Ctsc UTSW 7 88297159 missense probably damaging 0.98
R8157:Ctsc UTSW 7 88302208 missense probably benign 0.01
R8331:Ctsc UTSW 7 88297120 missense possibly damaging 0.53
R8392:Ctsc UTSW 7 88297243 missense probably benign 0.00
R8971:Ctsc UTSW 7 88309816 missense probably benign 0.00
R9005:Ctsc UTSW 7 88278294 missense probably damaging 1.00
R9113:Ctsc UTSW 7 88309896 missense possibly damaging 0.93
R9131:Ctsc UTSW 7 88309808 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGAGTATAGAAGTTGTGCCTG -3'
(R):5'- CAGCATGATTTGTCAGCTCG -3'

Sequencing Primer
(F):5'- ATAGAAGTTGTGCCTGCCTTC -3'
(R):5'- CATGATTTGTCAGCTCGAAGGG -3'
Posted On 2019-06-26