Incidental Mutation 'R7254:Lars2'
ID 564143
Institutional Source Beutler Lab
Gene Symbol Lars2
Ensembl Gene ENSMUSG00000035202
Gene Name leucyl-tRNA synthetase, mitochondrial
Synonyms Kiaa0028
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 123366927-123462666 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123454963 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 739 (T739A)
Ref Sequence ENSEMBL: ENSMUSP00000036710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]
AlphaFold Q8VDC0
Predicted Effect possibly damaging
Transcript: ENSMUST00000038863
AA Change: T739A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: T739A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 57 223 7.6e-24 PFAM
Pfam:tRNA-synt_1g 83 239 9.3e-20 PFAM
Pfam:tRNA-synt_1_2 269 430 1.1e-8 PFAM
Pfam:tRNA-synt_1 434 609 5.6e-8 PFAM
Pfam:tRNA-synt_1g 589 682 1.2e-6 PFAM
Pfam:tRNA-synt_1 633 678 1.6e-7 PFAM
Pfam:Anticodon_1 724 867 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217116
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Lars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Lars2 APN 9 123453248 missense probably damaging 0.98
IGL01993:Lars2 APN 9 123394943 splice site probably benign
IGL02155:Lars2 APN 9 123454982 missense probably damaging 0.99
IGL02941:Lars2 APN 9 123459585 missense probably damaging 0.97
IGL03090:Lars2 APN 9 123455960 missense probably damaging 1.00
IGL03271:Lars2 APN 9 123459484 splice site probably null
IGL03386:Lars2 APN 9 123453390 nonsense probably null
IGL03410:Lars2 APN 9 123418776 missense possibly damaging 0.87
ulrich UTSW 9 123418693 missense probably damaging 0.99
K3955:Lars2 UTSW 9 123377777 missense probably damaging 1.00
P0038:Lars2 UTSW 9 123377777 missense probably damaging 1.00
R0276:Lars2 UTSW 9 123438121 splice site probably benign
R1671:Lars2 UTSW 9 123418279 missense probably benign 0.02
R1829:Lars2 UTSW 9 123431917 missense probably benign 0.00
R2219:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R2220:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R4610:Lars2 UTSW 9 123418693 missense probably damaging 0.99
R5027:Lars2 UTSW 9 123441495 missense probably benign 0.38
R5195:Lars2 UTSW 9 123453310 missense probably damaging 0.97
R5597:Lars2 UTSW 9 123454982 missense probably damaging 0.99
R5756:Lars2 UTSW 9 123438199 missense probably damaging 1.00
R5783:Lars2 UTSW 9 123461596 missense probably benign
R6045:Lars2 UTSW 9 123371988 missense probably damaging 1.00
R6235:Lars2 UTSW 9 123411880 missense probably damaging 1.00
R6323:Lars2 UTSW 9 123441594 nonsense probably null
R6377:Lars2 UTSW 9 123454760 missense probably benign 0.00
R6395:Lars2 UTSW 9 123371925 missense probably benign 0.06
R7094:Lars2 UTSW 9 123459585 missense probably damaging 0.99
R7144:Lars2 UTSW 9 123431993 missense probably damaging 1.00
R7233:Lars2 UTSW 9 123411954 nonsense probably null
R7350:Lars2 UTSW 9 123427480 missense probably damaging 1.00
R7413:Lars2 UTSW 9 123459503 missense probably benign 0.30
R7614:Lars2 UTSW 9 123395111 missense
R7683:Lars2 UTSW 9 123377830 critical splice donor site probably null
R8000:Lars2 UTSW 9 123436244 missense probably damaging 1.00
R8061:Lars2 UTSW 9 123459497 missense probably benign
R8355:Lars2 UTSW 9 123454715 missense probably damaging 1.00
R8364:Lars2 UTSW 9 123411954 nonsense probably null
R8818:Lars2 UTSW 9 123392827 missense possibly damaging 0.94
R9007:Lars2 UTSW 9 123431915 nonsense probably null
R9351:Lars2 UTSW 9 123436301 missense probably benign 0.38
Z1177:Lars2 UTSW 9 123454782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCATCGAGGCAAGGACTTCC -3'
(R):5'- TCTTACAAGAGGCCTGAAGC -3'

Sequencing Primer
(F):5'- AAGGACTTCCGGGACAGTC -3'
(R):5'- TCATTGTAAGTTGAAGGCCAGCC -3'
Posted On 2019-06-26