Incidental Mutation 'R7254:Prr29'
ID 564151
Institutional Source Beutler Lab
Gene Symbol Prr29
Ensembl Gene ENSMUSG00000009210
Gene Name proline rich 29
Synonyms 2310007L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 106365472-106377558 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 106374858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000139960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001055] [ENSMUST00000009354] [ENSMUST00000106813] [ENSMUST00000106816] [ENSMUST00000185986] [ENSMUST00000188561] [ENSMUST00000190268] [ENSMUST00000190795]
AlphaFold B1ARI9
Predicted Effect probably benign
Transcript: ENSMUST00000001055
SMART Domains Protein: ENSMUSP00000001055
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 8.6e-45 PFAM
Blast:IG_like 119 215 2e-36 BLAST
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000009354
SMART Domains Protein: ENSMUSP00000009354
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106813
SMART Domains Protein: ENSMUSP00000102426
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 2.8e-45 PFAM
Blast:IG_like 119 161 9e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106816
AA Change: M1L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102429
Gene: ENSMUSG00000009210
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173795
SMART Domains Protein: ENSMUSP00000133315
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
Pfam:ICAM_N 1 50 2.2e-21 PFAM
Blast:IG_like 55 151 2e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185986
AA Change: M1L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140365
Gene: ENSMUSG00000009210
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DUF4587 32 103 1.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188561
AA Change: M1L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140194
Gene: ENSMUSG00000009210
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DUF4587 39 101 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190268
AA Change: M1L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139960
Gene: ENSMUSG00000009210
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190795
SMART Domains Protein: ENSMUSP00000140541
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Meta Mutation Damage Score 0.7546 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Prr29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Prr29 APN 11 106375207 missense possibly damaging 0.93
Partisans UTSW 11 106376259 missense probably damaging 0.96
R0027:Prr29 UTSW 11 106376276 missense possibly damaging 0.81
R0193:Prr29 UTSW 11 106376896 missense probably damaging 1.00
R1707:Prr29 UTSW 11 106376683 missense probably damaging 0.99
R1861:Prr29 UTSW 11 106375438 missense probably damaging 1.00
R3125:Prr29 UTSW 11 106374885 missense probably benign 0.00
R4664:Prr29 UTSW 11 106376333 missense probably damaging 1.00
R4998:Prr29 UTSW 11 106376953 missense probably benign 0.01
R6244:Prr29 UTSW 11 106376632 splice site probably null
R6492:Prr29 UTSW 11 106375236 missense probably damaging 1.00
R7069:Prr29 UTSW 11 106376259 missense probably damaging 0.96
R7611:Prr29 UTSW 11 106376332 missense probably damaging 1.00
R8023:Prr29 UTSW 11 106376273 missense probably benign 0.45
R8039:Prr29 UTSW 11 106376912 missense probably benign 0.10
Z1176:Prr29 UTSW 11 106376941 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGAACAAAAGTGGGTCACCC -3'
(R):5'- AATGTCTCTGCACCTCATGACC -3'

Sequencing Primer
(F):5'- TCACCCAGGGTTAGCGC -3'
(R):5'- ACTCTCTTCCTCTTAGTTAGGGATC -3'
Posted On 2019-06-26