Incidental Mutation 'R7254:Cep295nl'
ID 564152
Institutional Source Beutler Lab
Gene Symbol Cep295nl
Ensembl Gene ENSMUSG00000076433
Gene Name CEP295 N-terminal like
Synonyms Ddc8, BC100451
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 118332360-118342500 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 118333040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 326 (P326Q)
Ref Sequence ENSEMBL: ENSMUSP00000099313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017610] [ENSMUST00000103024] [ENSMUST00000155707] [ENSMUST00000168100]
AlphaFold Q497N6
Predicted Effect probably benign
Transcript: ENSMUST00000017610
SMART Domains Protein: ENSMUSP00000017610
Gene: ENSMUSG00000017466

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
NTR 27 203 1.05e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103024
AA Change: P326Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099313
Gene: ENSMUSG00000076433
AA Change: P326Q

DomainStartEndE-ValueType
coiled coil region 43 72 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
low complexity region 273 282 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
low complexity region 451 468 N/A INTRINSIC
coiled coil region 495 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155707
SMART Domains Protein: ENSMUSP00000122642
Gene: ENSMUSG00000017466

DomainStartEndE-ValueType
NTR 1 126 1.48e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168100
AA Change: P326Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128122
Gene: ENSMUSG00000076433
AA Change: P326Q

DomainStartEndE-ValueType
coiled coil region 43 72 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
low complexity region 273 282 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
low complexity region 451 468 N/A INTRINSIC
coiled coil region 495 524 N/A INTRINSIC
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Cep295nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cep295nl APN 11 118333904 missense probably damaging 0.96
IGL02883:Cep295nl APN 11 118333909 missense probably benign 0.01
R1724:Cep295nl UTSW 11 118333028 missense probably benign 0.03
R1815:Cep295nl UTSW 11 118332648 missense probably damaging 1.00
R1999:Cep295nl UTSW 11 118333089 missense probably damaging 0.99
R2161:Cep295nl UTSW 11 118332509 missense possibly damaging 0.65
R2198:Cep295nl UTSW 11 118332593 missense probably benign 0.00
R4871:Cep295nl UTSW 11 118333824 missense probably damaging 0.98
R5348:Cep295nl UTSW 11 118333599 missense probably damaging 0.98
R5759:Cep295nl UTSW 11 118333646 missense possibly damaging 0.94
R6379:Cep295nl UTSW 11 118333730 missense probably benign 0.04
R7038:Cep295nl UTSW 11 118332989 missense probably benign 0.27
R7456:Cep295nl UTSW 11 118333550 missense possibly damaging 0.88
R7494:Cep295nl UTSW 11 118333932 missense probably benign
R8982:Cep295nl UTSW 11 118333845 missense probably damaging 1.00
R9303:Cep295nl UTSW 11 118333940 missense possibly damaging 0.90
R9305:Cep295nl UTSW 11 118333940 missense possibly damaging 0.90
R9451:Cep295nl UTSW 11 118333620 nonsense probably null
R9617:Cep295nl UTSW 11 118333174 missense possibly damaging 0.65
R9621:Cep295nl UTSW 11 118333940 missense possibly damaging 0.90
Z1176:Cep295nl UTSW 11 118333019 missense possibly damaging 0.90
Z1176:Cep295nl UTSW 11 118333873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTCTGGGCTTAGTGAGAG -3'
(R):5'- GTACAACAAGAATCTGTGGCAC -3'

Sequencing Primer
(F):5'- AGTGAGAGTAAGTCATCTTGTTCTC -3'
(R):5'- TGTGGCACAAAGAAATCGAATCTAC -3'
Posted On 2019-06-26