Incidental Mutation 'R7254:Tubb2a'
ID 564154
Institutional Source Beutler Lab
Gene Symbol Tubb2a
Ensembl Gene ENSMUSG00000058672
Gene Name tubulin, beta 2A class IIA
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 34074274-34078007 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34074532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 425 (Y425C)
Ref Sequence ENSEMBL: ENSMUSP00000060246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040656] [ENSMUST00000056427]
AlphaFold Q7TMM9
Predicted Effect probably benign
Transcript: ENSMUST00000040656
SMART Domains Protein: ENSMUSP00000046168
Gene: ENSMUSG00000038286

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:Hydrolase_4 57 208 1.1e-10 PFAM
Pfam:Abhydrolase_1 61 205 2.8e-22 PFAM
Pfam:Abhydrolase_5 62 273 3.9e-20 PFAM
Pfam:Abhydrolase_6 63 285 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056427
AA Change: Y425C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060246
Gene: ENSMUSG00000058672
AA Change: Y425C

DomainStartEndE-ValueType
Tubulin 47 244 1.64e-65 SMART
Tubulin_C 246 383 2.39e-49 SMART
low complexity region 431 444 N/A INTRINSIC
Meta Mutation Damage Score 0.4097 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, key participants in processes such as mitosis and intracellular transport, are composed of heterodimers of alpha- and beta-tubulins. The protein encoded by this gene is a beta-tubulin. Defects in this gene are associated with complex cortical dysplasia with other brain malformations-5. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Tubb2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:Tubb2a APN 13 34076547 critical splice donor site probably null
R0233:Tubb2a UTSW 13 34075342 missense possibly damaging 0.50
R0233:Tubb2a UTSW 13 34075342 missense possibly damaging 0.50
R0345:Tubb2a UTSW 13 34076637 missense probably benign
R2033:Tubb2a UTSW 13 34075456 missense probably damaging 1.00
R3732:Tubb2a UTSW 13 34075264 missense probably damaging 1.00
R3836:Tubb2a UTSW 13 34075311 missense probably benign 0.30
R3837:Tubb2a UTSW 13 34075311 missense probably benign 0.30
R3839:Tubb2a UTSW 13 34075311 missense probably benign 0.30
R4879:Tubb2a UTSW 13 34074589 missense probably benign 0.02
R4936:Tubb2a UTSW 13 34075257 nonsense probably null
R5537:Tubb2a UTSW 13 34075451 missense probably benign 0.07
R5889:Tubb2a UTSW 13 34075468 missense possibly damaging 0.92
R6102:Tubb2a UTSW 13 34075343 missense probably benign 0.00
R6475:Tubb2a UTSW 13 34075459 missense possibly damaging 0.91
R7206:Tubb2a UTSW 13 34075522 missense possibly damaging 0.80
R7260:Tubb2a UTSW 13 34075414 missense probably damaging 1.00
R7631:Tubb2a UTSW 13 34075244 missense probably damaging 0.99
R7734:Tubb2a UTSW 13 34074793 missense probably benign 0.06
R7815:Tubb2a UTSW 13 34074979 missense probably benign 0.10
R7850:Tubb2a UTSW 13 34074571 missense probably damaging 1.00
R9091:Tubb2a UTSW 13 34074595 missense probably damaging 1.00
R9170:Tubb2a UTSW 13 34076645 missense probably benign
R9270:Tubb2a UTSW 13 34074595 missense probably damaging 1.00
R9799:Tubb2a UTSW 13 34076624 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGATCTTGAAAGAGGTTCACAC -3'
(R):5'- CAAGATGTCAGCCACCTTCATTG -3'

Sequencing Primer
(F):5'- GAGGTTCACACTATTACATCAACAG -3'
(R):5'- CAAGGCTTTCCTGCACT -3'
Posted On 2019-06-26