Mutagenetix > Incidental Mutation

Incidental Mutation 'R7254:Iars'

564155

Institutional Source

Beutler Lab

Gene Symbol

Iars

Ensembl Gene

ENSMUSG00000037851

Gene Name

isoleucine-tRNA synthetase

Synonyms

E430001P04Rik, 2510016L12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49682100-49734267 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 49723078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000164260] [ENSMUST00000165316] [ENSMUST00000165316]

AlphaFold

Q8BU30

Predicted Effect

probably null
Transcript: ENSMUST00000047363

SMART Domains

Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	9.2e-242	PFAM
Pfam:tRNA-synt_1g	46	197	3.7e-6	PFAM
Pfam:Anticodon_1	693	852	1.1e-23	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047363

SMART Domains

Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	9.2e-242	PFAM
Pfam:tRNA-synt_1g	46	197	3.7e-6	PFAM
Pfam:Anticodon_1	693	852	1.1e-23	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164260

SMART Domains

Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164260

SMART Domains

Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165316

SMART Domains

Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165316

SMART Domains

Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,741,976	I677V	probably benign	Het
4931406B18Rik	A	T	7: 43,498,199	D249E	probably damaging	Het
Acacb	A	C	5: 114,209,751		probably null	Het
Adnp	A	G	2: 168,183,998	V459A	probably damaging	Het
Arid3b	T	C	9: 57,796,754	K304E	probably damaging	Het
Ash1l	G	T	3: 89,070,509	R2713L	probably damaging	Het
Bmpr1a	A	C	14: 34,414,763	D490E	probably benign	Het
Cacna1g	A	T	11: 94,432,567	C1270*	probably null	Het
Cep295nl	G	T	11: 118,333,040	P326Q	probably damaging	Het
Cfap100	T	C	6: 90,406,061	I377V	unknown	Het
Creb1	C	T	1: 64,576,277	Q223*	probably null	Het
Ctsc	G	A	7: 88,309,559	G349D	probably damaging	Het
Ddx41	G	A	13: 55,533,956	R311*	probably null	Het
Dse	T	A	10: 34,184,148		probably benign	Het
Eef2k	C	T	7: 120,889,265	H458Y	probably benign	Het
Gipr	A	T	7: 19,163,613	V90E	probably damaging	Het
Gm14412	A	T	2: 177,317,396	D22E	probably damaging	Het
Gm17018	A	G	19: 45,577,034	Q149R	probably benign	Het
Gm21886	A	T	18: 80,089,735	C69*	probably null	Het
Gm5114	G	A	7: 39,408,966	L410F	probably benign	Het
Gmip	T	A	8: 69,816,468		probably null	Het
Gtf2f1	T	C	17: 57,007,101	T128A	possibly damaging	Het
Hnrnpr	A	G	4: 136,332,575	E330G	possibly damaging	Het
Hoxd9	T	A	2: 74,698,374	W107R	probably damaging	Het
Idh2	TCCCAGGGCC	TCC	7: 80,098,331		probably null	Het
Ifi213	G	T	1: 173,593,963	P120Q	probably damaging	Het
Il6	A	T	5: 30,014,908	Q94L	probably benign	Het
Kcnab1	A	G	3: 65,319,487	S196G	probably benign	Het
Kcnv1	C	T	15: 45,113,208	V228I	probably benign	Het
Lars2	A	G	9: 123,454,963	T739A	possibly damaging	Het
Med13	T	C	11: 86,319,835	S494G	probably benign	Het
Mtrf1	GCCTTC	GC	14: 79,423,491		probably null	Het
Myh9	T	G	15: 77,765,824	Q1646P	probably damaging	Het
Nif3l1	T	A	1: 58,450,466	S171R	probably benign	Het
Olfr143	T	C	9: 38,253,423	M2T	probably benign	Het
Olfr1467	A	T	19: 13,365,111	D161V	probably benign	Het
Olfr376	A	G	11: 73,375,375	I212V	probably benign	Het
Olfr398	A	G	11: 73,983,777	V277A	probably benign	Het
Olfr564	A	G	7: 102,803,558	T27A	probably benign	Het
Olfr702	A	G	7: 106,823,570	*319Q	probably null	Het
Olfr785	T	C	10: 129,409,780	V138A	probably benign	Het
Pak7	A	T	2: 136,116,764	S135T	possibly damaging	Het
Prr29	A	T	11: 106,374,858	M1L	probably damaging	Het
Ptpn13	T	A	5: 103,594,636	V2407E	probably damaging	Het
Ralgapa1	T	A	12: 55,695,193	H1310L	probably damaging	Het
Raph1	T	C	1: 60,499,608	S393G	unknown	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Ror2	A	G	13: 53,118,720	I303T	possibly damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn10a	C	T	9: 119,618,855	D1378N	probably damaging	Het
Serpinc1	T	A	1: 160,993,618	C91S	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tada1	T	A	1: 166,388,648	C139*	probably null	Het
Tbr1	T	A	2: 61,806,042	V254E	probably damaging	Het
Timd4	A	T	11: 46,843,189	I340F	probably benign	Het
Tubb2a	T	C	13: 34,074,532	Y425C	probably damaging	Het
Wdr60	A	G	12: 116,262,585		probably benign	Het
Zfp292	A	T	4: 34,819,476	M287K	probably damaging	Het

Other mutations in Iars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00697:Iars	APN	13	49709728	missense	probably damaging	1.00
IGL00764:Iars	APN	13	49711827	missense	probably benign	0.34
IGL01153:Iars	APN	13	49711805	missense	probably damaging	1.00
IGL01481:Iars	APN	13	49728698	missense	probably benign	0.00
IGL01596:Iars	APN	13	49703176	missense	probably benign
IGL01682:Iars	APN	13	49709658	missense	probably damaging	1.00
IGL01885:Iars	APN	13	49691499	missense	probably benign	0.25
IGL01907:Iars	APN	13	49709655	missense	probably damaging	1.00
IGL02023:Iars	APN	13	49688249	missense	probably damaging	1.00
IGL02121:Iars	APN	13	49724696	missense	probably benign	0.00
IGL02365:Iars	APN	13	49691499	missense	probably benign	0.25
IGL02704:Iars	APN	13	49721100	missense	probably damaging	1.00
IGL02838:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL02975:Iars	APN	13	49704849	missense	probably damaging	1.00
IGL02982:Iars	APN	13	49709709	missense	probably benign	0.00
IGL03034:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL03060:Iars	APN	13	49690447	critical splice acceptor site	probably null
IGL03156:Iars	APN	13	49703179	missense	possibly damaging	0.87
IGL03206:Iars	APN	13	49693070	missense	possibly damaging	0.81
IGL03343:Iars	APN	13	49724747	missense	probably benign	0.12
gannett_peak	UTSW	13	49708421	missense	probably damaging	1.00
missouri	UTSW	13	49688276	missense	possibly damaging	0.82
spacex	UTSW	13	49723002	missense	possibly damaging	0.85
wind_river	UTSW	13	49701895	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0184:Iars	UTSW	13	49722212	missense	probably benign	0.00
R0200:Iars	UTSW	13	49726202	missense	possibly damaging	0.62
R0356:Iars	UTSW	13	49703233	missense	probably benign	0.03
R0383:Iars	UTSW	13	49732342	missense	probably damaging	0.99
R0657:Iars	UTSW	13	49702519	missense	probably damaging	1.00
R1005:Iars	UTSW	13	49687445	missense	possibly damaging	0.94
R1427:Iars	UTSW	13	49704269	critical splice acceptor site	probably null
R1449:Iars	UTSW	13	49733710	missense	probably damaging	0.99
R1647:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1648:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1664:Iars	UTSW	13	49711775	missense	probably damaging	0.98
R1763:Iars	UTSW	13	49723077	critical splice donor site	probably null
R2192:Iars	UTSW	13	49688129	splice site	probably null
R2203:Iars	UTSW	13	49722675	missense	probably benign	0.00
R2357:Iars	UTSW	13	49688203	missense	probably damaging	1.00
R3724:Iars	UTSW	13	49687384	critical splice acceptor site	probably null
R4785:Iars	UTSW	13	49724663	missense	probably damaging	0.99
R4934:Iars	UTSW	13	49717984	missense	probably benign	0.17
R4999:Iars	UTSW	13	49709661	missense	probably damaging	1.00
R5048:Iars	UTSW	13	49688237	missense	probably damaging	0.99
R5268:Iars	UTSW	13	49690491	missense	probably damaging	1.00
R5394:Iars	UTSW	13	49722165	missense	probably damaging	1.00
R5486:Iars	UTSW	13	49709573	splice site	probably null
R5960:Iars	UTSW	13	49724637	missense	possibly damaging	0.68
R5972:Iars	UTSW	13	49709632	missense	possibly damaging	0.91
R5978:Iars	UTSW	13	49722993	missense	probably damaging	0.99
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6092:Iars	UTSW	13	49708421	missense	probably damaging	1.00
R6167:Iars	UTSW	13	49722714	missense	probably damaging	1.00
R6313:Iars	UTSW	13	49708445	missense	probably damaging	0.99
R6358:Iars	UTSW	13	49727143	missense	possibly damaging	0.67
R6385:Iars	UTSW	13	49701895	missense	probably damaging	1.00
R6403:Iars	UTSW	13	49687495	missense	probably damaging	1.00
R6575:Iars	UTSW	13	49725269	missense	probably damaging	1.00
R6675:Iars	UTSW	13	49719578	missense	probably damaging	0.99
R6957:Iars	UTSW	13	49722161	missense	probably damaging	1.00
R7207:Iars	UTSW	13	49688315	critical splice donor site	probably null
R7354:Iars	UTSW	13	49704320	missense	probably benign
R7397:Iars	UTSW	13	49728677	missense	probably benign	0.00
R7696:Iars	UTSW	13	49706738	missense	probably damaging	1.00
R7799:Iars	UTSW	13	49723018	missense	probably damaging	1.00
R7828:Iars	UTSW	13	49725272	missense	probably benign
R8679:Iars	UTSW	13	49703199	unclassified	probably benign
R8768:Iars	UTSW	13	49724626	missense	probably damaging	0.99
R8797:Iars	UTSW	13	49688262	missense	probably benign	0.12
R8906:Iars	UTSW	13	49728701	missense	probably benign
R8990:Iars	UTSW	13	49688276	missense	possibly damaging	0.82
R9134:Iars	UTSW	13	49701847	missense	probably benign	0.00
R9137:Iars	UTSW	13	49701874	missense	probably benign
R9394:Iars	UTSW	13	49730060	missense	probably benign
R9668:Iars	UTSW	13	49687409	missense	probably damaging	0.98
R9741:Iars	UTSW	13	49691502	missense	probably damaging	0.99
Z1088:Iars	UTSW	13	49721088	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGAATGGCCTGGAGCTAGC -3'
(R):5'- CCCTAGTGCATTCACAAACTGC -3'

Sequencing Primer
(F):5'- GCTTAGCTAAATAGTAACCAGACAG -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCTG -3'

Posted On

2019-06-26