Mutagenetix > Incidental Mutation

Incidental Mutation 'R7254:Ror2'

564156

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53118720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 303 (I303T)

Ref Sequence

ENSEMBL: ENSMUSP00000021918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021918
AA Change: I303T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: I303T

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130235
AA Change: I291T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: I291T

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,741,976	I677V	probably benign	Het
4931406B18Rik	A	T	7: 43,498,199	D249E	probably damaging	Het
Acacb	A	C	5: 114,209,751		probably null	Het
Adnp	A	G	2: 168,183,998	V459A	probably damaging	Het
Arid3b	T	C	9: 57,796,754	K304E	probably damaging	Het
Ash1l	G	T	3: 89,070,509	R2713L	probably damaging	Het
Bmpr1a	A	C	14: 34,414,763	D490E	probably benign	Het
Cacna1g	A	T	11: 94,432,567	C1270*	probably null	Het
Cep295nl	G	T	11: 118,333,040	P326Q	probably damaging	Het
Cfap100	T	C	6: 90,406,061	I377V	unknown	Het
Creb1	C	T	1: 64,576,277	Q223*	probably null	Het
Ctsc	G	A	7: 88,309,559	G349D	probably damaging	Het
Ddx41	G	A	13: 55,533,956	R311*	probably null	Het
Dse	T	A	10: 34,184,148		probably benign	Het
Eef2k	C	T	7: 120,889,265	H458Y	probably benign	Het
Gipr	A	T	7: 19,163,613	V90E	probably damaging	Het
Gm14412	A	T	2: 177,317,396	D22E	probably damaging	Het
Gm17018	A	G	19: 45,577,034	Q149R	probably benign	Het
Gm21886	A	T	18: 80,089,735	C69*	probably null	Het
Gm5114	G	A	7: 39,408,966	L410F	probably benign	Het
Gmip	T	A	8: 69,816,468		probably null	Het
Gtf2f1	T	C	17: 57,007,101	T128A	possibly damaging	Het
Hnrnpr	A	G	4: 136,332,575	E330G	possibly damaging	Het
Hoxd9	T	A	2: 74,698,374	W107R	probably damaging	Het
Iars	T	C	13: 49,723,078		probably null	Het
Idh2	TCCCAGGGCC	TCC	7: 80,098,331		probably null	Het
Ifi213	G	T	1: 173,593,963	P120Q	probably damaging	Het
Il6	A	T	5: 30,014,908	Q94L	probably benign	Het
Kcnab1	A	G	3: 65,319,487	S196G	probably benign	Het
Kcnv1	C	T	15: 45,113,208	V228I	probably benign	Het
Lars2	A	G	9: 123,454,963	T739A	possibly damaging	Het
Med13	T	C	11: 86,319,835	S494G	probably benign	Het
Mtrf1	GCCTTC	GC	14: 79,423,491		probably null	Het
Myh9	T	G	15: 77,765,824	Q1646P	probably damaging	Het
Nif3l1	T	A	1: 58,450,466	S171R	probably benign	Het
Olfr143	T	C	9: 38,253,423	M2T	probably benign	Het
Olfr1467	A	T	19: 13,365,111	D161V	probably benign	Het
Olfr376	A	G	11: 73,375,375	I212V	probably benign	Het
Olfr398	A	G	11: 73,983,777	V277A	probably benign	Het
Olfr564	A	G	7: 102,803,558	T27A	probably benign	Het
Olfr702	A	G	7: 106,823,570	*319Q	probably null	Het
Olfr785	T	C	10: 129,409,780	V138A	probably benign	Het
Pak7	A	T	2: 136,116,764	S135T	possibly damaging	Het
Prr29	A	T	11: 106,374,858	M1L	probably damaging	Het
Ptpn13	T	A	5: 103,594,636	V2407E	probably damaging	Het
Ralgapa1	T	A	12: 55,695,193	H1310L	probably damaging	Het
Raph1	T	C	1: 60,499,608	S393G	unknown	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn10a	C	T	9: 119,618,855	D1378N	probably damaging	Het
Serpinc1	T	A	1: 160,993,618	C91S	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tada1	T	A	1: 166,388,648	C139*	probably null	Het
Tbr1	T	A	2: 61,806,042	V254E	probably damaging	Het
Timd4	A	T	11: 46,843,189	I340F	probably benign	Het
Tubb2a	T	C	13: 34,074,532	Y425C	probably damaging	Het
Wdr60	A	G	12: 116,262,585		probably benign	Het
Zfp292	A	T	4: 34,819,476	M287K	probably damaging	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
lavage	UTSW	13	53118982	missense	probably damaging	1.00
tendrils	UTSW	13	53111451	missense	probably damaging	0.96
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00
R8031:Ror2	UTSW	13	53113157	missense	probably damaging	1.00
R8479:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R8684:Ror2	UTSW	13	53110266	missense	possibly damaging	0.90
R8834:Ror2	UTSW	13	53110302	small deletion	probably benign
R8948:Ror2	UTSW	13	53131996	missense	possibly damaging	0.67
R9233:Ror2	UTSW	13	53111554	missense	probably benign
R9234:Ror2	UTSW	13	53111338	missense	probably damaging	1.00
R9573:Ror2	UTSW	13	53111431	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATCTGGCGCAGGTTAACCAC -3'
(R):5'- CCAGTGTTCACAGTTTGCCATC -3'

Sequencing Primer
(F):5'- CCCAGCCACTAGAGGGCTTC -3'
(R):5'- GTGTTCACAGTTTGCCATCCCATC -3'

Posted On

2019-06-26