Incidental Mutation 'R7254:1700014D04Rik'
ID 564158
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene Name RIKEN cDNA 1700014D04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 59740842-59746752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59741976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 677 (I677V)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
AlphaFold J3QMS2
Predicted Effect unknown
Transcript: ENSMUST00000055343
AA Change: I259V
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054
AA Change: I259V

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180139
AA Change: I677V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: I677V

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB010:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
BB020:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 splice site probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7536:1700014D04Rik UTSW 13 59741742 missense probably damaging 0.99
R7729:1700014D04Rik UTSW 13 59741623 missense not run
R7912:1700014D04Rik UTSW 13 59742515 missense probably damaging 1.00
R7933:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R8029:1700014D04Rik UTSW 13 59742377 missense possibly damaging 0.79
R8347:1700014D04Rik UTSW 13 59742236 missense possibly damaging 0.63
R8370:1700014D04Rik UTSW 13 59743952 missense probably benign
R8395:1700014D04Rik UTSW 13 59741726 missense probably benign 0.00
R8508:1700014D04Rik UTSW 13 59743598 missense probably benign 0.02
R8930:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R8932:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R9127:1700014D04Rik UTSW 13 59743014 missense probably benign 0.00
R9262:1700014D04Rik UTSW 13 59742588 missense probably benign 0.00
R9401:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R9514:1700014D04Rik UTSW 13 59742992 missense probably damaging 0.96
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGCTGTTGGAAGAAGACG -3'
(R):5'- CGTGACTCTGTCTGACTCAG -3'

Sequencing Primer
(F):5'- CTGTCTGAGACAAAGGATGACTC -3'
(R):5'- TCAGAGAATGAGAGCGCAAG -3'
Posted On 2019-06-26