Incidental Mutation 'R7254:Bmpr1a'
ID 564159
Institutional Source Beutler Lab
Gene Symbol Bmpr1a
Ensembl Gene ENSMUSG00000021796
Gene Name bone morphogenetic protein receptor, type 1A
Synonyms BMPR-IA, 1110037I22Rik, Bmpr, ALK3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34410734-34503341 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34414763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 490 (D490E)
Ref Sequence ENSEMBL: ENSMUSP00000035900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049005] [ENSMUST00000165280]
AlphaFold P36895
Predicted Effect probably benign
Transcript: ENSMUST00000049005
AA Change: D490E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000035900
Gene: ENSMUSG00000021796
AA Change: D490E

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 4.6e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165280
AA Change: D490E

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131984
Gene: ENSMUSG00000021796
AA Change: D490E

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 1.3e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 9.5, are smaller than normal, and form no mesoderm; a conditional knockout resulted in gross malformations of the limbs with complete agenesis of the hindlimb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Bmpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Bmpr1a APN 14 34434419 missense probably benign
IGL03100:Bmpr1a APN 14 34441207 unclassified probably benign
R0329:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0330:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0411:Bmpr1a UTSW 14 34415877 missense possibly damaging 0.58
R0537:Bmpr1a UTSW 14 34443812 unclassified probably benign
R1707:Bmpr1a UTSW 14 34425141 splice site probably benign
R1767:Bmpr1a UTSW 14 34447770 critical splice donor site probably null
R1992:Bmpr1a UTSW 14 34425093 missense probably damaging 1.00
R3757:Bmpr1a UTSW 14 34434667 nonsense probably null
R4125:Bmpr1a UTSW 14 34434733 missense probably benign 0.35
R5320:Bmpr1a UTSW 14 34425042 missense probably damaging 1.00
R6956:Bmpr1a UTSW 14 34441175 missense possibly damaging 0.90
R7267:Bmpr1a UTSW 14 34443879 missense possibly damaging 0.47
R7270:Bmpr1a UTSW 14 34441125 missense probably damaging 0.96
R8166:Bmpr1a UTSW 14 34425069 missense probably damaging 1.00
R8348:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
R8448:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
R8948:Bmpr1a UTSW 14 34441191 missense possibly damaging 0.69
R8950:Bmpr1a UTSW 14 34441191 missense possibly damaging 0.69
R9246:Bmpr1a UTSW 14 34434707 missense probably benign 0.00
R9362:Bmpr1a UTSW 14 34434403 missense probably benign 0.01
R9647:Bmpr1a UTSW 14 34414737 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAAGTGTCTTCTTGATTCTCAAAGC -3'
(R):5'- TCCACAATTCAGTGAGAAATGCTG -3'

Sequencing Primer
(F):5'- CTTGATTCTCAAAGCTGTGAGTC -3'
(R):5'- CTGTATGTCAACTGAGAGTAGTCC -3'
Posted On 2019-06-26