Incidental Mutation 'R7254:Mtrf1'
ID 564160
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Name mitochondrial translational release factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R7254 (G1)
Quality Score 217.468
Status Validated
Chromosome 14
Chromosomal Location 79397772-79423587 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GCCTTC to GC at 79423491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]
AlphaFold Q8K126
Predicted Effect probably null
Transcript: ENSMUST00000022600
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061222
SMART Domains Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881

DomainStartEndE-ValueType
Blast:BTB 11 44 2e-11 BLAST
BTB 63 168 1.05e-23 SMART
BACK 173 279 1.41e-19 SMART
low complexity region 317 340 N/A INTRINSIC
Pfam:Kelch_1 434 481 1.7e-9 PFAM
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79423425 missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79402920 splice site probably benign
IGL01866:Mtrf1 APN 14 79401508 missense probably benign
IGL02290:Mtrf1 APN 14 79401811 nonsense probably null
IGL02929:Mtrf1 APN 14 79402833 missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79415980 missense possibly damaging 0.80
IGL03342:Mtrf1 APN 14 79415871 splice site probably benign
IGL03342:Mtrf1 APN 14 79415872 splice site probably null
R0212:Mtrf1 UTSW 14 79419279 missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79406850 missense probably damaging 1.00
R0604:Mtrf1 UTSW 14 79415887 missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79419268 nonsense probably null
R0981:Mtrf1 UTSW 14 79401590 missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79401833 missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79401671 missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79419267 missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79413080 missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79411650 missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79401688 missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79406587 missense probably benign
R5616:Mtrf1 UTSW 14 79401445 missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79402891 missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79413081 missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79423491 frame shift probably null
R7182:Mtrf1 UTSW 14 79423464 missense possibly damaging 0.60
R7871:Mtrf1 UTSW 14 79406938 missense probably benign 0.19
R8249:Mtrf1 UTSW 14 79401479 missense probably benign 0.23
R9593:Mtrf1 UTSW 14 79419224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGTTCCATTGGGAGACAC -3'
(R):5'- GGAGAGCTGGATTATTTACTGAAACC -3'

Sequencing Primer
(F):5'- AGGCCTAATGTTTACCACATGGG -3'
(R):5'- CTCTGTAGGCACATCTATAC -3'
Posted On 2019-06-26