Incidental Mutation 'R7254:Mtrf1'
ID 564160
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Name mitochondrial translational release factor 1
Synonyms A830062K05Rik
MMRRC Submission 045315-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7254 (G1)
Quality Score 217.468
Status Validated
Chromosome 14
Chromosomal Location 79635212-79661027 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GCCTTC to GC at 79660931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]
AlphaFold Q8K126
Predicted Effect probably null
Transcript: ENSMUST00000022600
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061222
SMART Domains Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881

DomainStartEndE-ValueType
Blast:BTB 11 44 2e-11 BLAST
BTB 63 168 1.05e-23 SMART
BACK 173 279 1.41e-19 SMART
low complexity region 317 340 N/A INTRINSIC
Pfam:Kelch_1 434 481 1.7e-9 PFAM
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A T 7: 43,147,623 (GRCm39) D249E probably damaging Het
Acacb A C 5: 114,347,812 (GRCm39) probably null Het
Adnp A G 2: 168,025,918 (GRCm39) V459A probably damaging Het
Arid3b T C 9: 57,704,037 (GRCm39) K304E probably damaging Het
Ash1l G T 3: 88,977,816 (GRCm39) R2713L probably damaging Het
Bmpr1a A C 14: 34,136,720 (GRCm39) D490E probably benign Het
Cacna1g A T 11: 94,323,393 (GRCm39) C1270* probably null Het
Cep295nl G T 11: 118,223,866 (GRCm39) P326Q probably damaging Het
Cfap100 T C 6: 90,383,043 (GRCm39) I377V unknown Het
Creb1 C T 1: 64,615,436 (GRCm39) Q223* probably null Het
Ctsc G A 7: 87,958,767 (GRCm39) G349D probably damaging Het
Ddx41 G A 13: 55,681,769 (GRCm39) R311* probably null Het
Dpcd A G 19: 45,565,473 (GRCm39) Q149R probably benign Het
Dse T A 10: 34,060,144 (GRCm39) probably benign Het
Dync2i1 A G 12: 116,226,205 (GRCm39) probably benign Het
Eef2k C T 7: 120,488,488 (GRCm39) H458Y probably benign Het
Gipr A T 7: 18,897,538 (GRCm39) V90E probably damaging Het
Gm14412 A T 2: 177,009,189 (GRCm39) D22E probably damaging Het
Gm21886 A T 18: 80,132,950 (GRCm39) C69* probably null Het
Gm5114 G A 7: 39,058,390 (GRCm39) L410F probably benign Het
Gmip T A 8: 70,269,118 (GRCm39) probably null Het
Gtf2f1 T C 17: 57,314,101 (GRCm39) T128A possibly damaging Het
Hnrnpr A G 4: 136,059,886 (GRCm39) E330G possibly damaging Het
Hoxd9 T A 2: 74,528,718 (GRCm39) W107R probably damaging Het
Iars1 T C 13: 49,876,554 (GRCm39) probably null Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Ifi213 G T 1: 173,421,529 (GRCm39) P120Q probably damaging Het
Il6 A T 5: 30,219,906 (GRCm39) Q94L probably benign Het
Kcnab1 A G 3: 65,226,908 (GRCm39) S196G probably benign Het
Kcnv1 C T 15: 44,976,604 (GRCm39) V228I probably benign Het
Lars2 A G 9: 123,284,028 (GRCm39) T739A possibly damaging Het
Med13 T C 11: 86,210,661 (GRCm39) S494G probably benign Het
Myh9 T G 15: 77,650,024 (GRCm39) Q1646P probably damaging Het
Nif3l1 T A 1: 58,489,625 (GRCm39) S171R probably benign Het
Or13n4 A G 7: 106,422,777 (GRCm39) *319Q probably null Het
Or1e1c A G 11: 73,266,201 (GRCm39) I212V probably benign Het
Or1r1 A G 11: 73,874,603 (GRCm39) V277A probably benign Het
Or51f23 A G 7: 102,452,765 (GRCm39) T27A probably benign Het
Or5b113 A T 19: 13,342,475 (GRCm39) D161V probably benign Het
Or6c5b T C 10: 129,245,649 (GRCm39) V138A probably benign Het
Or8c8 T C 9: 38,164,719 (GRCm39) M2T probably benign Het
Pak5 A T 2: 135,958,684 (GRCm39) S135T possibly damaging Het
Prr29 A T 11: 106,265,684 (GRCm39) M1L probably damaging Het
Ptpn13 T A 5: 103,742,502 (GRCm39) V2407E probably damaging Het
Ralgapa1 T A 12: 55,741,978 (GRCm39) H1310L probably damaging Het
Raph1 T C 1: 60,538,767 (GRCm39) S393G unknown Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ror2 A G 13: 53,272,756 (GRCm39) I303T possibly damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn10a C T 9: 119,447,921 (GRCm39) D1378N probably damaging Het
Serpinc1 T A 1: 160,821,188 (GRCm39) C91S probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spata31d1e T C 13: 59,889,790 (GRCm39) I677V probably benign Het
Tada1 T A 1: 166,216,217 (GRCm39) C139* probably null Het
Tbr1 T A 2: 61,636,386 (GRCm39) V254E probably damaging Het
Timd4 A T 11: 46,734,016 (GRCm39) I340F probably benign Het
Tubb2a T C 13: 34,258,515 (GRCm39) Y425C probably damaging Het
Zfp292 A T 4: 34,819,476 (GRCm39) M287K probably damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79,660,865 (GRCm39) missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79,640,360 (GRCm39) splice site probably benign
IGL01866:Mtrf1 APN 14 79,638,948 (GRCm39) missense probably benign
IGL02290:Mtrf1 APN 14 79,639,251 (GRCm39) nonsense probably null
IGL02929:Mtrf1 APN 14 79,640,273 (GRCm39) missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79,653,312 (GRCm39) splice site probably null
IGL03342:Mtrf1 APN 14 79,653,311 (GRCm39) splice site probably benign
IGL03342:Mtrf1 APN 14 79,653,420 (GRCm39) missense possibly damaging 0.80
R0212:Mtrf1 UTSW 14 79,656,719 (GRCm39) missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79,644,290 (GRCm39) missense probably damaging 1.00
R0604:Mtrf1 UTSW 14 79,653,327 (GRCm39) missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79,656,708 (GRCm39) nonsense probably null
R0981:Mtrf1 UTSW 14 79,639,030 (GRCm39) missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79,639,273 (GRCm39) missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79,639,111 (GRCm39) missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79,656,707 (GRCm39) missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79,650,520 (GRCm39) missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79,649,090 (GRCm39) missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79,639,128 (GRCm39) missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79,644,027 (GRCm39) missense probably benign
R5616:Mtrf1 UTSW 14 79,638,885 (GRCm39) missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79,640,331 (GRCm39) missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79,650,521 (GRCm39) missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79,660,931 (GRCm39) frame shift probably null
R7182:Mtrf1 UTSW 14 79,660,904 (GRCm39) missense possibly damaging 0.60
R7871:Mtrf1 UTSW 14 79,644,378 (GRCm39) missense probably benign 0.19
R8249:Mtrf1 UTSW 14 79,638,919 (GRCm39) missense probably benign 0.23
R9593:Mtrf1 UTSW 14 79,656,664 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGTTCCATTGGGAGACAC -3'
(R):5'- GGAGAGCTGGATTATTTACTGAAACC -3'

Sequencing Primer
(F):5'- AGGCCTAATGTTTACCACATGGG -3'
(R):5'- CTCTGTAGGCACATCTATAC -3'
Posted On 2019-06-26