Mutagenetix > Incidental Mutation

Incidental Mutation 'R7254:Mtrf1'

564160

Institutional Source

Beutler Lab

Gene Symbol

Mtrf1

Ensembl Gene

ENSMUSG00000022022

Gene Name

mitochondrial translational release factor 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R7254 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

79397772-79423587 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCTTC to GC at 79423491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]

AlphaFold

Q8K126

Predicted Effect

probably null
Transcript: ENSMUST00000022600

SMART Domains

Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

Domain	Start	End	E-Value	Type
low complexity region	104	119	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
PCRF	139	255	5.96e-27	SMART
Pfam:RF-1	290	400	2.6e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061222

SMART Domains

Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881

Domain	Start	End	E-Value	Type
Blast:BTB	11	44	2e-11	BLAST
BTB	63	168	1.05e-23	SMART
BACK	173	279	1.41e-19	SMART
low complexity region	317	340	N/A	INTRINSIC
Pfam:Kelch_1	434	481	1.7e-9	PFAM
low complexity region	657	676	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,741,976	I677V	probably benign	Het
4931406B18Rik	A	T	7: 43,498,199	D249E	probably damaging	Het
Acacb	A	C	5: 114,209,751		probably null	Het
Adnp	A	G	2: 168,183,998	V459A	probably damaging	Het
Arid3b	T	C	9: 57,796,754	K304E	probably damaging	Het
Ash1l	G	T	3: 89,070,509	R2713L	probably damaging	Het
Bmpr1a	A	C	14: 34,414,763	D490E	probably benign	Het
Cacna1g	A	T	11: 94,432,567	C1270*	probably null	Het
Cep295nl	G	T	11: 118,333,040	P326Q	probably damaging	Het
Cfap100	T	C	6: 90,406,061	I377V	unknown	Het
Creb1	C	T	1: 64,576,277	Q223*	probably null	Het
Ctsc	G	A	7: 88,309,559	G349D	probably damaging	Het
Ddx41	G	A	13: 55,533,956	R311*	probably null	Het
Dse	T	A	10: 34,184,148		probably benign	Het
Eef2k	C	T	7: 120,889,265	H458Y	probably benign	Het
Gipr	A	T	7: 19,163,613	V90E	probably damaging	Het
Gm14412	A	T	2: 177,317,396	D22E	probably damaging	Het
Gm17018	A	G	19: 45,577,034	Q149R	probably benign	Het
Gm21886	A	T	18: 80,089,735	C69*	probably null	Het
Gm5114	G	A	7: 39,408,966	L410F	probably benign	Het
Gmip	T	A	8: 69,816,468		probably null	Het
Gtf2f1	T	C	17: 57,007,101	T128A	possibly damaging	Het
Hnrnpr	A	G	4: 136,332,575	E330G	possibly damaging	Het
Hoxd9	T	A	2: 74,698,374	W107R	probably damaging	Het
Iars	T	C	13: 49,723,078		probably null	Het
Idh2	TCCCAGGGCC	TCC	7: 80,098,331		probably null	Het
Ifi213	G	T	1: 173,593,963	P120Q	probably damaging	Het
Il6	A	T	5: 30,014,908	Q94L	probably benign	Het
Kcnab1	A	G	3: 65,319,487	S196G	probably benign	Het
Kcnv1	C	T	15: 45,113,208	V228I	probably benign	Het
Lars2	A	G	9: 123,454,963	T739A	possibly damaging	Het
Med13	T	C	11: 86,319,835	S494G	probably benign	Het
Myh9	T	G	15: 77,765,824	Q1646P	probably damaging	Het
Nif3l1	T	A	1: 58,450,466	S171R	probably benign	Het
Olfr143	T	C	9: 38,253,423	M2T	probably benign	Het
Olfr1467	A	T	19: 13,365,111	D161V	probably benign	Het
Olfr376	A	G	11: 73,375,375	I212V	probably benign	Het
Olfr398	A	G	11: 73,983,777	V277A	probably benign	Het
Olfr564	A	G	7: 102,803,558	T27A	probably benign	Het
Olfr702	A	G	7: 106,823,570	*319Q	probably null	Het
Olfr785	T	C	10: 129,409,780	V138A	probably benign	Het
Pak7	A	T	2: 136,116,764	S135T	possibly damaging	Het
Prr29	A	T	11: 106,374,858	M1L	probably damaging	Het
Ptpn13	T	A	5: 103,594,636	V2407E	probably damaging	Het
Ralgapa1	T	A	12: 55,695,193	H1310L	probably damaging	Het
Raph1	T	C	1: 60,499,608	S393G	unknown	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Ror2	A	G	13: 53,118,720	I303T	possibly damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn10a	C	T	9: 119,618,855	D1378N	probably damaging	Het
Serpinc1	T	A	1: 160,993,618	C91S	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tada1	T	A	1: 166,388,648	C139*	probably null	Het
Tbr1	T	A	2: 61,806,042	V254E	probably damaging	Het
Timd4	A	T	11: 46,843,189	I340F	probably benign	Het
Tubb2a	T	C	13: 34,074,532	Y425C	probably damaging	Het
Wdr60	A	G	12: 116,262,585		probably benign	Het
Zfp292	A	T	4: 34,819,476	M287K	probably damaging	Het

Other mutations in Mtrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Mtrf1	APN	14	79423425	missense	probably benign	0.10
IGL01478:Mtrf1	APN	14	79402920	splice site	probably benign
IGL01866:Mtrf1	APN	14	79401508	missense	probably benign
IGL02290:Mtrf1	APN	14	79401811	nonsense	probably null
IGL02929:Mtrf1	APN	14	79402833	missense	probably benign	0.00
IGL03342:Mtrf1	APN	14	79415980	missense	possibly damaging	0.80
IGL03342:Mtrf1	APN	14	79415871	splice site	probably benign
IGL03342:Mtrf1	APN	14	79415872	splice site	probably null
R0212:Mtrf1	UTSW	14	79419279	missense	probably benign	0.02
R0560:Mtrf1	UTSW	14	79406850	missense	probably damaging	1.00
R0604:Mtrf1	UTSW	14	79415887	missense	possibly damaging	0.92
R0669:Mtrf1	UTSW	14	79419268	nonsense	probably null
R0981:Mtrf1	UTSW	14	79401590	missense	probably benign	0.04
R1837:Mtrf1	UTSW	14	79401833	missense	possibly damaging	0.89
R1969:Mtrf1	UTSW	14	79401671	missense	probably damaging	1.00
R3883:Mtrf1	UTSW	14	79419267	missense	probably damaging	1.00
R4739:Mtrf1	UTSW	14	79413080	missense	probably damaging	1.00
R4748:Mtrf1	UTSW	14	79411650	missense	probably damaging	1.00
R4780:Mtrf1	UTSW	14	79401688	missense	probably benign	0.02
R4965:Mtrf1	UTSW	14	79406587	missense	probably benign
R5616:Mtrf1	UTSW	14	79401445	missense	possibly damaging	0.68
R6530:Mtrf1	UTSW	14	79402891	missense	possibly damaging	0.89
R6776:Mtrf1	UTSW	14	79413081	missense	probably damaging	1.00
R7095:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7182:Mtrf1	UTSW	14	79423464	missense	possibly damaging	0.60
R7871:Mtrf1	UTSW	14	79406938	missense	probably benign	0.19
R8249:Mtrf1	UTSW	14	79401479	missense	probably benign	0.23
R9593:Mtrf1	UTSW	14	79419224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCAGTTCCATTGGGAGACAC -3'
(R):5'- GGAGAGCTGGATTATTTACTGAAACC -3'

Sequencing Primer
(F):5'- AGGCCTAATGTTTACCACATGGG -3'
(R):5'- CTCTGTAGGCACATCTATAC -3'

Posted On

2019-06-26