Incidental Mutation 'R7254:Myh9'
ID 564162
Institutional Source Beutler Lab
Gene Symbol Myh9
Ensembl Gene ENSMUSG00000022443
Gene Name myosin, heavy polypeptide 9, non-muscle
Synonyms NMHC II-A, D0Jmb2, myosin IIA, Fltn, Myhn1, Myhn-1, E030044M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 77760587-77842175 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 77765824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 1646 (Q1646P)
Ref Sequence ENSEMBL: ENSMUSP00000016771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016771]
AlphaFold Q8VDD5
Predicted Effect probably damaging
Transcript: ENSMUST00000016771
AA Change: Q1646P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016771
Gene: ENSMUSG00000022443
AA Change: Q1646P

DomainStartEndE-ValueType
Pfam:Myosin_N 29 69 3.4e-11 PFAM
MYSc 75 777 N/A SMART
IQ 778 800 1.46e-3 SMART
Pfam:Myosin_tail_1 841 1921 N/A PFAM
low complexity region 1948 1959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229259
Meta Mutation Damage Score 0.8918 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display hearing loss with incomplete penetrance. Mice homozygous or heterozygous for one of several knock-in alleles exhibit macrothrombocytopenia, nephritis, cataracts and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Myh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Myh9 APN 15 77796995 splice site probably benign
IGL01105:Myh9 APN 15 77781478 missense probably benign 0.01
IGL01137:Myh9 APN 15 77769542 missense probably benign 0.19
IGL01399:Myh9 APN 15 77767270 missense probably damaging 1.00
IGL01666:Myh9 APN 15 77761931 missense probably benign 0.31
IGL01832:Myh9 APN 15 77791753 missense probably benign 0.02
IGL01933:Myh9 APN 15 77781218 missense probably benign 0.00
IGL02049:Myh9 APN 15 77769870 missense probably benign 0.01
IGL02237:Myh9 APN 15 77786654 missense probably benign 0.03
IGL02243:Myh9 APN 15 77767482 missense probably damaging 1.00
IGL02248:Myh9 APN 15 77786614 missense probably damaging 0.99
IGL02292:Myh9 APN 15 77807996 missense probably damaging 1.00
IGL02315:Myh9 APN 15 77769973 missense probably benign 0.00
IGL02427:Myh9 APN 15 77775804 missense probably damaging 0.98
IGL02675:Myh9 APN 15 77788930 missense possibly damaging 0.89
IGL02727:Myh9 APN 15 77791742 missense probably benign 0.11
IGL02749:Myh9 APN 15 77807986 nonsense probably null
IGL02887:Myh9 APN 15 77796020 nonsense probably null
IGL02926:Myh9 APN 15 77787626 missense probably damaging 1.00
IGL02945:Myh9 APN 15 77762005 missense probably benign 0.05
IGL03137:Myh9 APN 15 77791089 missense probably damaging 1.00
R0784:Myh9 UTSW 15 77777009 splice site probably benign
R1375:Myh9 UTSW 15 77769368 splice site probably null
R1535:Myh9 UTSW 15 77777813 missense probably damaging 0.98
R1563:Myh9 UTSW 15 77771857 missense probably damaging 0.99
R1629:Myh9 UTSW 15 77764401 missense probably damaging 1.00
R1635:Myh9 UTSW 15 77771167 missense probably benign 0.06
R1635:Myh9 UTSW 15 77775899 missense probably benign 0.00
R1693:Myh9 UTSW 15 77812897 missense probably damaging 1.00
R1791:Myh9 UTSW 15 77773264 unclassified probably benign
R2010:Myh9 UTSW 15 77771947 missense probably benign 0.06
R2048:Myh9 UTSW 15 77771132 missense possibly damaging 0.70
R2078:Myh9 UTSW 15 77763912 missense probably benign 0.16
R2092:Myh9 UTSW 15 77764350 nonsense probably null
R2376:Myh9 UTSW 15 77783417 missense probably benign 0.18
R2922:Myh9 UTSW 15 77813184 missense probably damaging 1.00
R3709:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3710:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3737:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3738:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3739:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R4299:Myh9 UTSW 15 77769964 missense probably benign
R4384:Myh9 UTSW 15 77791712 splice site probably benign
R4514:Myh9 UTSW 15 77764000 missense probably benign
R4631:Myh9 UTSW 15 77797028 missense probably damaging 0.99
R4642:Myh9 UTSW 15 77761951 missense probably benign 0.10
R4695:Myh9 UTSW 15 77768853 missense probably damaging 0.99
R4709:Myh9 UTSW 15 77787517 missense probably damaging 1.00
R4766:Myh9 UTSW 15 77807877 missense probably damaging 0.97
R4826:Myh9 UTSW 15 77788946 nonsense probably null
R4842:Myh9 UTSW 15 77769253 missense probably damaging 0.99
R4946:Myh9 UTSW 15 77773340 missense probably damaging 1.00
R5030:Myh9 UTSW 15 77807798 intron probably benign
R5055:Myh9 UTSW 15 77764523 missense probably benign 0.12
R5202:Myh9 UTSW 15 77781110 critical splice donor site probably null
R5413:Myh9 UTSW 15 77807986 nonsense probably null
R5435:Myh9 UTSW 15 77769609 missense probably benign 0.00
R5701:Myh9 UTSW 15 77791764 missense probably benign 0.00
R5757:Myh9 UTSW 15 77771162 missense probably benign 0.44
R5793:Myh9 UTSW 15 77768877 missense probably benign 0.23
R5952:Myh9 UTSW 15 77773332 missense possibly damaging 0.65
R6248:Myh9 UTSW 15 77785222 nonsense probably null
R6648:Myh9 UTSW 15 77766772 missense probably benign 0.08
R7055:Myh9 UTSW 15 77775198 missense probably damaging 1.00
R7106:Myh9 UTSW 15 77775121 missense probably benign
R7180:Myh9 UTSW 15 77807910 missense probably benign 0.00
R7205:Myh9 UTSW 15 77783472 missense probably benign 0.08
R7284:Myh9 UTSW 15 77787596 missense probably damaging 1.00
R7417:Myh9 UTSW 15 77763865 nonsense probably null
R7695:Myh9 UTSW 15 77766736 missense probably benign 0.31
R7750:Myh9 UTSW 15 77783410 missense probably benign 0.01
R7854:Myh9 UTSW 15 77791753 missense probably benign 0.02
R8220:Myh9 UTSW 15 77764547 missense possibly damaging 0.87
R8324:Myh9 UTSW 15 77788917 critical splice donor site probably null
R8837:Myh9 UTSW 15 77776937 missense possibly damaging 0.71
R8944:Myh9 UTSW 15 77771232 missense probably benign
R9025:Myh9 UTSW 15 77768992 missense probably benign
R9229:Myh9 UTSW 15 77790817 missense possibly damaging 0.91
R9396:Myh9 UTSW 15 77763296 missense probably benign
Z1088:Myh9 UTSW 15 77775258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACTCCTACTCCTGAG -3'
(R):5'- GTCTAGTAAGGAAGGCACACGC -3'

Sequencing Primer
(F):5'- TACAGCTGCTGCCCTGAG -3'
(R):5'- CAGAGCCACCTGCCTTTG -3'
Posted On 2019-06-26