Incidental Mutation 'R7254:Gtf2f1'
ID 564165
Institutional Source Beutler Lab
Gene Symbol Gtf2f1
Ensembl Gene ENSMUSG00000002658
Gene Name general transcription factor IIF, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 57003405-57011288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57007101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 128 (T128A)
Ref Sequence ENSEMBL: ENSMUSP00000002733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002733] [ENSMUST00000210548]
AlphaFold Q3THK3
Predicted Effect possibly damaging
Transcript: ENSMUST00000002733
AA Change: T128A

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002733
Gene: ENSMUSG00000002658
AA Change: T128A

DomainStartEndE-ValueType
Pfam:TFIIF_alpha 2 508 2.6e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Gtf2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:Gtf2f1 APN 17 57003918 missense possibly damaging 0.86
IGL02752:Gtf2f1 APN 17 57009682 unclassified probably benign
IGL03022:Gtf2f1 APN 17 57010971 splice site probably null
IGL03094:Gtf2f1 APN 17 57007049 missense probably damaging 1.00
R0242:Gtf2f1 UTSW 17 57003802 missense probably benign 0.26
R0242:Gtf2f1 UTSW 17 57003802 missense probably benign 0.26
R0480:Gtf2f1 UTSW 17 57004307 critical splice donor site probably null
R1255:Gtf2f1 UTSW 17 57010982 missense probably damaging 1.00
R2270:Gtf2f1 UTSW 17 57003462 missense probably null 0.00
R4209:Gtf2f1 UTSW 17 57011003 missense probably benign 0.01
R4637:Gtf2f1 UTSW 17 57004534 missense probably benign 0.20
R5102:Gtf2f1 UTSW 17 57003626 missense probably damaging 1.00
R5103:Gtf2f1 UTSW 17 57004519 missense probably damaging 0.97
R6167:Gtf2f1 UTSW 17 57004161 missense probably damaging 1.00
R6707:Gtf2f1 UTSW 17 57007770 missense probably benign 0.00
R7259:Gtf2f1 UTSW 17 57004562 missense probably damaging 0.96
R7307:Gtf2f1 UTSW 17 57007833 missense probably damaging 1.00
R7683:Gtf2f1 UTSW 17 57005458 missense possibly damaging 0.94
R9727:Gtf2f1 UTSW 17 57011005 missense possibly damaging 0.75
R9765:Gtf2f1 UTSW 17 57011125 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGGTACCAGCCTTCAC -3'
(R):5'- GTAGCACATGCCCTTCTGTC -3'

Sequencing Primer
(F):5'- CTCAAGCAAGAGAGGTCTGCC -3'
(R):5'- TGTCCTAATCATTCCTAGAAGAGCC -3'
Posted On 2019-06-26