Incidental Mutation 'R7254:Olfr1467'
ID 564167
Institutional Source Beutler Lab
Gene Symbol Olfr1467
Ensembl Gene ENSMUSG00000049015
Gene Name olfactory receptor 1467
Synonyms MOR202-15, GA_x6K02T2RE5P-3695694-3696620
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13362236-13368054 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13365111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 161 (D161V)
Ref Sequence ENSEMBL: ENSMUSP00000149487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054687] [ENSMUST00000215096]
AlphaFold Q8VFW1
Predicted Effect probably benign
Transcript: ENSMUST00000054687
AA Change: D161V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061580
Gene: ENSMUSG00000049015
AA Change: D161V

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6.6e-48 PFAM
Pfam:7tm_1 40 289 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215096
AA Change: D161V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Olfr1467
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Olfr1467 APN 19 13364624 utr 5 prime probably benign
IGL01109:Olfr1467 APN 19 13364699 missense probably benign
IGL01939:Olfr1467 APN 19 13365443 missense probably benign 0.14
IGL02188:Olfr1467 APN 19 13365032 missense probably benign 0.39
IGL02188:Olfr1467 APN 19 13365279 missense probably damaging 0.98
IGL03223:Olfr1467 APN 19 13365281 missense probably benign
R0456:Olfr1467 UTSW 19 13364738 missense probably damaging 0.98
R1066:Olfr1467 UTSW 19 13365087 missense probably benign
R1189:Olfr1467 UTSW 19 13365179 missense probably benign 0.03
R1668:Olfr1467 UTSW 19 13364870 missense probably benign 0.00
R1754:Olfr1467 UTSW 19 13365353 missense probably damaging 1.00
R1860:Olfr1467 UTSW 19 13365341 missense possibly damaging 0.80
R1861:Olfr1467 UTSW 19 13365341 missense possibly damaging 0.80
R2181:Olfr1467 UTSW 19 13365074 missense probably benign 0.08
R2219:Olfr1467 UTSW 19 13365537 missense possibly damaging 0.88
R2516:Olfr1467 UTSW 19 13365193 nonsense probably null
R4757:Olfr1467 UTSW 19 13365446 missense probably benign 0.23
R5206:Olfr1467 UTSW 19 13365065 missense possibly damaging 0.91
R5376:Olfr1467 UTSW 19 13365398 missense possibly damaging 0.95
R5647:Olfr1467 UTSW 19 13365177 missense probably damaging 1.00
R5724:Olfr1467 UTSW 19 13365151 missense possibly damaging 0.62
R5741:Olfr1467 UTSW 19 13365483 missense probably damaging 0.97
R5906:Olfr1467 UTSW 19 13365005 missense probably damaging 1.00
R6636:Olfr1467 UTSW 19 13365225 missense probably benign 0.06
R6637:Olfr1467 UTSW 19 13365225 missense probably benign 0.06
R7000:Olfr1467 UTSW 19 13364623 start gained probably benign
R7325:Olfr1467 UTSW 19 13364637 missense probably benign 0.00
R7773:Olfr1467 UTSW 19 13365234 missense probably benign 0.07
R7828:Olfr1467 UTSW 19 13365146 missense probably benign 0.10
R9081:Olfr1467 UTSW 19 13364655 missense probably benign 0.12
R9135:Olfr1467 UTSW 19 13365391 missense possibly damaging 0.46
R9151:Olfr1467 UTSW 19 13364858 missense possibly damaging 0.95
R9470:Olfr1467 UTSW 19 13364751 missense probably damaging 1.00
R9792:Olfr1467 UTSW 19 13365150 missense probably damaging 0.99
R9793:Olfr1467 UTSW 19 13365150 missense probably damaging 0.99
Z1176:Olfr1467 UTSW 19 13364915 missense probably damaging 1.00
Z1176:Olfr1467 UTSW 19 13364916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTGTGCTGCTCAGATGTTC -3'
(R):5'- GCAGCTGATTGCATCTTCAC -3'

Sequencing Primer
(F):5'- GCTCAGATGTTCATTTTTGCAGC -3'
(R):5'- TGGTGACAAAAATGAACACATAGG -3'
Posted On 2019-06-26