Incidental Mutation 'R7254:Sorbs1'
ID 564168
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Name sorbin and SH3 domain containing 1
Synonyms c-Cbl-associated protein, Ponsin, CAP, 2310065E01Rik, 9530001P15Rik, Sh3d5
MMRRC Submission 045315-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.751) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40283197-40502223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 40365244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 180 (R180G)
Ref Sequence ENSEMBL: ENSMUSP00000153313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000099466
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165212
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165469
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224233
Predicted Effect probably benign
Transcript: ENSMUST00000224247
Predicted Effect probably benign
Transcript: ENSMUST00000224583
Predicted Effect probably benign
Transcript: ENSMUST00000224667
Predicted Effect probably benign
Transcript: ENSMUST00000225148
Predicted Effect probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225786
Predicted Effect probably benign
Transcript: ENSMUST00000226047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A T 7: 43,147,623 (GRCm39) D249E probably damaging Het
Acacb A C 5: 114,347,812 (GRCm39) probably null Het
Adnp A G 2: 168,025,918 (GRCm39) V459A probably damaging Het
Arid3b T C 9: 57,704,037 (GRCm39) K304E probably damaging Het
Ash1l G T 3: 88,977,816 (GRCm39) R2713L probably damaging Het
Bmpr1a A C 14: 34,136,720 (GRCm39) D490E probably benign Het
Cacna1g A T 11: 94,323,393 (GRCm39) C1270* probably null Het
Cep295nl G T 11: 118,223,866 (GRCm39) P326Q probably damaging Het
Cfap100 T C 6: 90,383,043 (GRCm39) I377V unknown Het
Creb1 C T 1: 64,615,436 (GRCm39) Q223* probably null Het
Ctsc G A 7: 87,958,767 (GRCm39) G349D probably damaging Het
Ddx41 G A 13: 55,681,769 (GRCm39) R311* probably null Het
Dpcd A G 19: 45,565,473 (GRCm39) Q149R probably benign Het
Dse T A 10: 34,060,144 (GRCm39) probably benign Het
Dync2i1 A G 12: 116,226,205 (GRCm39) probably benign Het
Eef2k C T 7: 120,488,488 (GRCm39) H458Y probably benign Het
Gipr A T 7: 18,897,538 (GRCm39) V90E probably damaging Het
Gm14412 A T 2: 177,009,189 (GRCm39) D22E probably damaging Het
Gm21886 A T 18: 80,132,950 (GRCm39) C69* probably null Het
Gm5114 G A 7: 39,058,390 (GRCm39) L410F probably benign Het
Gmip T A 8: 70,269,118 (GRCm39) probably null Het
Gtf2f1 T C 17: 57,314,101 (GRCm39) T128A possibly damaging Het
Hnrnpr A G 4: 136,059,886 (GRCm39) E330G possibly damaging Het
Hoxd9 T A 2: 74,528,718 (GRCm39) W107R probably damaging Het
Iars1 T C 13: 49,876,554 (GRCm39) probably null Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Ifi213 G T 1: 173,421,529 (GRCm39) P120Q probably damaging Het
Il6 A T 5: 30,219,906 (GRCm39) Q94L probably benign Het
Kcnab1 A G 3: 65,226,908 (GRCm39) S196G probably benign Het
Kcnv1 C T 15: 44,976,604 (GRCm39) V228I probably benign Het
Lars2 A G 9: 123,284,028 (GRCm39) T739A possibly damaging Het
Med13 T C 11: 86,210,661 (GRCm39) S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,660,931 (GRCm39) probably null Het
Myh9 T G 15: 77,650,024 (GRCm39) Q1646P probably damaging Het
Nif3l1 T A 1: 58,489,625 (GRCm39) S171R probably benign Het
Or13n4 A G 7: 106,422,777 (GRCm39) *319Q probably null Het
Or1e1c A G 11: 73,266,201 (GRCm39) I212V probably benign Het
Or1r1 A G 11: 73,874,603 (GRCm39) V277A probably benign Het
Or51f23 A G 7: 102,452,765 (GRCm39) T27A probably benign Het
Or5b113 A T 19: 13,342,475 (GRCm39) D161V probably benign Het
Or6c5b T C 10: 129,245,649 (GRCm39) V138A probably benign Het
Or8c8 T C 9: 38,164,719 (GRCm39) M2T probably benign Het
Pak5 A T 2: 135,958,684 (GRCm39) S135T possibly damaging Het
Prr29 A T 11: 106,265,684 (GRCm39) M1L probably damaging Het
Ptpn13 T A 5: 103,742,502 (GRCm39) V2407E probably damaging Het
Ralgapa1 T A 12: 55,741,978 (GRCm39) H1310L probably damaging Het
Raph1 T C 1: 60,538,767 (GRCm39) S393G unknown Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ror2 A G 13: 53,272,756 (GRCm39) I303T possibly damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn10a C T 9: 119,447,921 (GRCm39) D1378N probably damaging Het
Serpinc1 T A 1: 160,821,188 (GRCm39) C91S probably benign Het
Spata31d1e T C 13: 59,889,790 (GRCm39) I677V probably benign Het
Tada1 T A 1: 166,216,217 (GRCm39) C139* probably null Het
Tbr1 T A 2: 61,636,386 (GRCm39) V254E probably damaging Het
Timd4 A T 11: 46,734,016 (GRCm39) I340F probably benign Het
Tubb2a T C 13: 34,258,515 (GRCm39) Y425C probably damaging Het
Zfp292 A T 4: 34,819,476 (GRCm39) M287K probably damaging Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40,306,473 (GRCm39) missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40,332,795 (GRCm39) splice site probably null
IGL00788:Sorbs1 APN 19 40,325,487 (GRCm39) splice site probably benign
IGL00943:Sorbs1 APN 19 40,283,484 (GRCm39) utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40,338,422 (GRCm39) missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40,365,091 (GRCm39) missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40,306,460 (GRCm39) splice site probably benign
IGL02159:Sorbs1 APN 19 40,316,040 (GRCm39) missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40,302,841 (GRCm39) missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40,315,991 (GRCm39) missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40,353,577 (GRCm39) missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40,303,125 (GRCm39) missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40,365,348 (GRCm39) missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40,365,187 (GRCm39) missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40,302,820 (GRCm39) missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40,351,706 (GRCm39) missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40,332,858 (GRCm39) missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40,362,009 (GRCm39) missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0306:Sorbs1 UTSW 19 40,332,855 (GRCm39) missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40,338,392 (GRCm39) missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40,300,260 (GRCm39) missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40,351,706 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40,381,904 (GRCm39) missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40,353,472 (GRCm39) splice site probably null
R2148:Sorbs1 UTSW 19 40,365,268 (GRCm39) missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40,285,075 (GRCm39) missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40,361,959 (GRCm39) missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40,362,015 (GRCm39) missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40,302,887 (GRCm39) missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40,384,189 (GRCm39) missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40,300,294 (GRCm39) missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40,361,962 (GRCm39) missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40,328,491 (GRCm39) nonsense probably null
R4912:Sorbs1 UTSW 19 40,300,171 (GRCm39) missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40,329,151 (GRCm39) missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40,310,334 (GRCm39) missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40,365,433 (GRCm39) missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40,365,325 (GRCm39) missense probably benign
R5871:Sorbs1 UTSW 19 40,387,027 (GRCm39) missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40,313,216 (GRCm39) missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40,303,101 (GRCm39) missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40,310,263 (GRCm39) missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40,365,426 (GRCm39) critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40,314,496 (GRCm39) missense probably benign
R6646:Sorbs1 UTSW 19 40,313,993 (GRCm39) missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40,315,991 (GRCm39) missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6850:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6878:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6879:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6880:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6908:Sorbs1 UTSW 19 40,340,776 (GRCm39) missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40,316,060 (GRCm39) nonsense probably null
R7040:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7041:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7110:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7122:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7170:Sorbs1 UTSW 19 40,314,573 (GRCm39) nonsense probably null
R7180:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7185:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7187:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7255:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7401:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7595:Sorbs1 UTSW 19 40,303,097 (GRCm39) missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7876:Sorbs1 UTSW 19 40,285,032 (GRCm39) missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40,316,020 (GRCm39) missense probably benign 0.02
R7986:Sorbs1 UTSW 19 40,353,449 (GRCm39) missense probably damaging 0.99
R8031:Sorbs1 UTSW 19 40,314,933 (GRCm39) missense probably benign 0.17
R8082:Sorbs1 UTSW 19 40,353,527 (GRCm39) missense probably benign 0.08
R8282:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8283:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8446:Sorbs1 UTSW 19 40,314,602 (GRCm39) missense probably benign
R8526:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8527:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8528:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8539:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8540:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8542:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8543:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8544:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8545:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8684:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8699:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8702:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8752:Sorbs1 UTSW 19 40,349,872 (GRCm39) critical splice donor site probably null
R8937:Sorbs1 UTSW 19 40,362,006 (GRCm39) missense probably benign 0.02
R8956:Sorbs1 UTSW 19 40,351,660 (GRCm39) missense probably damaging 1.00
R8960:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9175:Sorbs1 UTSW 19 40,315,018 (GRCm39) missense probably damaging 1.00
R9208:Sorbs1 UTSW 19 40,353,462 (GRCm39) start gained probably benign
R9211:Sorbs1 UTSW 19 40,332,798 (GRCm39) critical splice donor site probably null
R9371:Sorbs1 UTSW 19 40,315,324 (GRCm39) missense probably damaging 0.98
R9374:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9377:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9551:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9552:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9686:Sorbs1 UTSW 19 40,381,954 (GRCm39) missense probably damaging 1.00
Z1177:Sorbs1 UTSW 19 40,315,339 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGCAAGCTTACGGTAC -3'
(R):5'- ACCCCTTATTTCCCACAGGG -3'

Sequencing Primer
(F):5'- AGCTTACGGTACTTGAGACAGCTC -3'
(R):5'- CAGCCCCGTCTGAGGTAATAGTTG -3'
Posted On 2019-06-26