Incidental Mutation 'R7255:Sulf1'
ID564170
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R7255 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12859008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 166 (D166E)
Ref Sequence ENSEMBL: ENSMUSP00000140517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000185780]
Predicted Effect probably benign
Transcript: ENSMUST00000088585
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177608
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180062
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185780
AA Change: D166E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7275:Sulf1 UTSW 1 12850965 utr 3 prime probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
R7796:Sulf1 UTSW 1 12858820 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGGTTTCTCTTCTCACAGAGGAC -3'
(R):5'- ACGTTGGTCTGTTCAGATGCAG -3'

Sequencing Primer
(F):5'- CTCTTCTCACAGAGGACAGTTATGG -3'
(R):5'- CAGATGCAGGGTTTGGAGG -3'
Posted On2019-06-26