Mutagenetix > Incidental Mutation

Incidental Mutation 'R7255:Sulf1'

564170

Institutional Source

Beutler Lab

Gene Symbol

Sulf1

Ensembl Gene

ENSMUSG00000016918

Gene Name

sulfatase 1

Synonyms

MMRRC Submission

045316-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.501) question?

Stock #

R7255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12692277-12861192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12859008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 166 (D166E)

Ref Sequence

ENSEMBL: ENSMUSP00000140517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000185780]

AlphaFold

Q8K007

Predicted Effect

probably benign
Transcript: ENSMUST00000088585

SMART Domains

Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177608

SMART Domains

Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	534	678	9.7e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000180062

SMART Domains

Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185780
AA Change: D166E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Sulf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Sulf1	APN	1	12820463	missense	probably damaging	0.99
IGL00788:Sulf1	APN	1	12848449	missense	probably damaging	0.99
IGL00845:Sulf1	APN	1	12796967	missense	probably damaging	1.00
IGL01606:Sulf1	APN	1	12836204	missense	possibly damaging	0.87
IGL01963:Sulf1	APN	1	12818507	missense	probably damaging	1.00
IGL01968:Sulf1	APN	1	12818451	missense	probably damaging	1.00
IGL02072:Sulf1	APN	1	12848208	missense	probably damaging	1.00
IGL02424:Sulf1	APN	1	12796840	missense	probably benign	0.28
IGL02519:Sulf1	APN	1	12838363	nonsense	probably null
IGL02601:Sulf1	APN	1	12786645	missense	probably damaging	1.00
IGL03066:Sulf1	APN	1	12807944	missense	probably damaging	0.99
IGL03200:Sulf1	APN	1	12786617	nonsense	probably null
PIT4480001:Sulf1	UTSW	1	12859413	missense	probably benign	0.01
PIT4519001:Sulf1	UTSW	1	12848171	missense	probably damaging	1.00
R0083:Sulf1	UTSW	1	12817417	missense	probably damaging	0.99
R0467:Sulf1	UTSW	1	12796920	missense	probably damaging	1.00
R0554:Sulf1	UTSW	1	12805194	missense	probably damaging	1.00
R0626:Sulf1	UTSW	1	12817492	splice site	probably null
R1083:Sulf1	UTSW	1	12836164	frame shift	probably null
R1084:Sulf1	UTSW	1	12836164	frame shift	probably null
R1498:Sulf1	UTSW	1	12848350	missense	probably damaging	1.00
R1523:Sulf1	UTSW	1	12817350	nonsense	probably null
R1854:Sulf1	UTSW	1	12838437	missense	probably benign	0.06
R1942:Sulf1	UTSW	1	12848173	missense	probably damaging	1.00
R1946:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R1998:Sulf1	UTSW	1	12858834	nonsense	probably null
R2034:Sulf1	UTSW	1	12820421	missense	probably damaging	1.00
R2068:Sulf1	UTSW	1	12840403	missense	probably damaging	1.00
R2113:Sulf1	UTSW	1	12848174	missense	probably damaging	0.99
R2277:Sulf1	UTSW	1	12796794	missense	probably benign	0.41
R3827:Sulf1	UTSW	1	12817432	missense	probably benign
R3874:Sulf1	UTSW	1	12817412	missense	probably damaging	1.00
R4488:Sulf1	UTSW	1	12786515	start gained	probably benign
R4619:Sulf1	UTSW	1	12786652	missense	probably damaging	1.00
R4743:Sulf1	UTSW	1	12836293	missense	probably benign	0.04
R4836:Sulf1	UTSW	1	12842686	missense	probably benign	0.02
R4918:Sulf1	UTSW	1	12818496	missense	probably damaging	1.00
R4958:Sulf1	UTSW	1	12796910	missense	probably benign	0.08
R5216:Sulf1	UTSW	1	12796874	missense	probably benign	0.28
R5225:Sulf1	UTSW	1	12841478	missense	probably benign
R5427:Sulf1	UTSW	1	12796912	missense	possibly damaging	0.84
R5450:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R5909:Sulf1	UTSW	1	12858815	missense	possibly damaging	0.94
R5912:Sulf1	UTSW	1	12786752	unclassified	probably benign
R5966:Sulf1	UTSW	1	12859412	missense	probably benign	0.06
R6339:Sulf1	UTSW	1	12838440	missense	probably damaging	1.00
R6841:Sulf1	UTSW	1	12838434	missense	probably damaging	1.00
R6880:Sulf1	UTSW	1	12842755	missense	probably damaging	1.00
R7110:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R7275:Sulf1	UTSW	1	12850965	splice site	probably null
R7386:Sulf1	UTSW	1	12838361	missense	probably benign	0.07
R7611:Sulf1	UTSW	1	12836243	missense	probably benign
R7732:Sulf1	UTSW	1	12842789	missense	probably benign	0.11
R7796:Sulf1	UTSW	1	12858820	missense	probably benign	0.27
R7898:Sulf1	UTSW	1	12805294	missense	probably damaging	1.00
R7984:Sulf1	UTSW	1	12859273	missense	probably benign	0.00
R8003:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R8684:Sulf1	UTSW	1	12796780	missense	probably benign	0.06
R8714:Sulf1	UTSW	1	12807917	missense	probably benign	0.07
R8723:Sulf1	UTSW	1	12786687	missense	probably damaging	1.00
R8988:Sulf1	UTSW	1	12836275	missense	probably benign
R9055:Sulf1	UTSW	1	12807963	missense	probably damaging	1.00
R9100:Sulf1	UTSW	1	12807894	missense	probably damaging	1.00
R9288:Sulf1	UTSW	1	12786603	missense	probably benign	0.09
R9358:Sulf1	UTSW	1	12820505	missense	probably damaging	1.00
R9387:Sulf1	UTSW	1	12838554	missense	probably benign	0.02
R9462:Sulf1	UTSW	1	12859235	missense	probably damaging	1.00
R9524:Sulf1	UTSW	1	12848398	missense	probably damaging	1.00
R9581:Sulf1	UTSW	1	12805254	missense	possibly damaging	0.66
R9664:Sulf1	UTSW	1	12820802	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGTTTCTCTTCTCACAGAGGAC -3'
(R):5'- ACGTTGGTCTGTTCAGATGCAG -3'

Sequencing Primer
(F):5'- CTCTTCTCACAGAGGACAGTTATGG -3'
(R):5'- CAGATGCAGGGTTTGGAGG -3'

Posted On

2019-06-26