Incidental Mutation 'R7255:Crisp4'
ID 564172
Institutional Source Beutler Lab
Gene Symbol Crisp4
Ensembl Gene ENSMUSG00000025774
Gene Name cysteine-rich secretory protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 18115191-18145902 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 18130231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 116 (A116S)
Ref Sequence ENSEMBL: ENSMUSP00000111001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026876] [ENSMUST00000115340] [ENSMUST00000115344]
AlphaFold E9PVG4
Predicted Effect probably damaging
Transcript: ENSMUST00000026876
AA Change: A77S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026876
Gene: ENSMUSG00000025774
AA Change: A77S

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
SCP 44 188 1.32e-45 SMART
Pfam:Crisp 200 254 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115340
AA Change: A73S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110997
Gene: ENSMUSG00000025774
AA Change: A73S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCP 40 184 1.32e-45 SMART
Pfam:Crisp 196 250 6.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115344
AA Change: A116S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111001
Gene: ENSMUSG00000025774
AA Change: A116S

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
SCP 83 227 1.32e-45 SMART
Pfam:Crisp 239 293 1.6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a null mutation display an impaired acrosome reaction in response to progesterone but are fertile with normal testis morphology and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Crisp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Crisp4 APN 1 18128647 missense probably damaging 1.00
IGL01071:Crisp4 APN 1 18137007 missense probably benign 0.41
IGL01641:Crisp4 APN 1 18124290 missense possibly damaging 0.91
IGL01670:Crisp4 APN 1 18128677 missense probably benign 0.03
IGL01985:Crisp4 APN 1 18134065 missense probably damaging 1.00
IGL02043:Crisp4 APN 1 18134100 missense probably damaging 1.00
R1241:Crisp4 UTSW 1 18122794 missense probably damaging 1.00
R1978:Crisp4 UTSW 1 18128665 missense probably benign 0.04
R5269:Crisp4 UTSW 1 18128710 missense probably damaging 1.00
R5736:Crisp4 UTSW 1 18115715 missense probably benign 0.03
R6154:Crisp4 UTSW 1 18122788 missense possibly damaging 0.80
R6999:Crisp4 UTSW 1 18137035 missense possibly damaging 0.56
R7446:Crisp4 UTSW 1 18122738 missense probably damaging 1.00
R7800:Crisp4 UTSW 1 18128749 missense probably benign 0.02
R7831:Crisp4 UTSW 1 18128789 missense probably benign 0.29
R7881:Crisp4 UTSW 1 18128669 missense probably benign 0.07
R8053:Crisp4 UTSW 1 18124274 missense probably benign 0.19
R8881:Crisp4 UTSW 1 18115678 missense probably damaging 0.96
R8885:Crisp4 UTSW 1 18136924 intron probably benign
R9188:Crisp4 UTSW 1 18122766 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCCCTCCCTTTGAATTGATCAG -3'
(R):5'- CAACCGATAAGTTGCTGGGTTAG -3'

Sequencing Primer
(F):5'- TTGAATTGATCAGCCCCACC -3'
(R):5'- ACAAGTTATGGTCTGAAGGTTATAAC -3'
Posted On 2019-06-26