Incidental Mutation 'R7255:Wdr26'
ID 564176
Institutional Source Beutler Lab
Gene Symbol Wdr26
Ensembl Gene ENSMUSG00000038733
Gene Name WD repeat domain 26
Synonyms Gid7, 1600024A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181173228-181211552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 181181324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 627 (I627R)
Ref Sequence ENSEMBL: ENSMUSP00000124592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162819] [ENSMUST00000162963]
AlphaFold Q8C6G8
Predicted Effect probably benign
Transcript: ENSMUST00000036329
SMART Domains Protein: ENSMUSP00000045177
Gene: ENSMUSG00000038733

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 43 70 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
LisH 100 132 9.73e-1 SMART
Blast:CTLH 133 183 6e-28 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000123863
Gene: ENSMUSG00000038733
AA Change: I103R

DomainStartEndE-ValueType
WD40 14 56 2.77e-1 SMART
WD40 59 99 3.83e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125023
Gene: ENSMUSG00000038733
AA Change: I130R

DomainStartEndE-ValueType
Blast:WD40 2 38 4e-12 BLAST
WD40 41 83 2.77e-1 SMART
WD40 86 126 3.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162819
AA Change: I627R

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124592
Gene: ENSMUSG00000038733
AA Change: I627R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 211 2.41e-5 SMART
low complexity region 276 287 N/A INTRINSIC
WD40 324 363 4.76e-6 SMART
WD40 370 411 1.35e-5 SMART
WD40 414 454 2.12e-3 SMART
WD40 537 579 2.77e-1 SMART
WD40 582 622 3.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162963
AA Change: I611R

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124186
Gene: ENSMUSG00000038733
AA Change: I611R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 195 4.97e-7 SMART
low complexity region 260 271 N/A INTRINSIC
WD40 308 347 4.76e-6 SMART
WD40 354 395 1.35e-5 SMART
WD40 398 438 2.12e-3 SMART
WD40 521 563 2.77e-1 SMART
WD40 566 606 3.83e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Wdr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Wdr26 APN 1 181191816 missense possibly damaging 0.86
IGL01941:Wdr26 APN 1 181211070 splice site probably benign
IGL02612:Wdr26 APN 1 181177796 utr 3 prime probably benign
IGL02660:Wdr26 APN 1 181198898 missense probably damaging 1.00
IGL02685:Wdr26 APN 1 181183780 missense possibly damaging 0.64
IGL02884:Wdr26 APN 1 181182784 missense probably damaging 1.00
R0396:Wdr26 UTSW 1 181180651 intron probably benign
R0453:Wdr26 UTSW 1 181182879 nonsense probably null
R0530:Wdr26 UTSW 1 181186070 splice site probably null
R0729:Wdr26 UTSW 1 181185905 splice site probably null
R1170:Wdr26 UTSW 1 181181294 splice site probably benign
R1466:Wdr26 UTSW 1 181185934 splice site probably benign
R1830:Wdr26 UTSW 1 181191775 missense probably damaging 1.00
R2883:Wdr26 UTSW 1 181211120 missense probably damaging 0.99
R4090:Wdr26 UTSW 1 181203114 missense probably damaging 1.00
R4097:Wdr26 UTSW 1 181182787 missense probably benign 0.00
R4953:Wdr26 UTSW 1 181197651 missense probably damaging 1.00
R5223:Wdr26 UTSW 1 181187686 missense probably benign 0.07
R5834:Wdr26 UTSW 1 181203147 missense probably damaging 1.00
R5884:Wdr26 UTSW 1 181187541 intron probably benign
R6174:Wdr26 UTSW 1 181191868 missense probably damaging 1.00
R6334:Wdr26 UTSW 1 181203206
R7161:Wdr26 UTSW 1 181203130 missense probably damaging 1.00
R7406:Wdr26 UTSW 1 181187675 missense probably damaging 1.00
R7804:Wdr26 UTSW 1 181182822 missense probably damaging 1.00
R7815:Wdr26 UTSW 1 181209073 missense probably benign 0.28
R8717:Wdr26 UTSW 1 181184348 missense possibly damaging 0.92
R9072:Wdr26 UTSW 1 181182786 missense probably damaging 0.99
R9358:Wdr26 UTSW 1 181191858 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAAAGCACAGGCATTAGGC -3'
(R):5'- AACGTGTGTAGTAACGTGGG -3'

Sequencing Primer
(F):5'- GGCATTAGGCTAGCTTACTTTCTTC -3'
(R):5'- GGGGTCAGTGATTTTGTTAATAACAC -3'
Posted On 2019-06-26